Entry information : CsPrx54 (orange1.1g018873m/orange1.1t02043)
Entry ID 8896
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx54 (orange1.1g018873m/orange1.1t02043)
Name (synonym) CsPrx54 (orange1.1g018873m/orange1.1t02043)
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx54
start..stop
S start..stop
CclPrx68 682 0 1..349 1..349
CclPrx05 662 0 1..349 1..350
CsPrx52 659 0 1..349 1..350
CsPrx61 652 0 1..349 1..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 44564..44782 219 N° 2 45185..45376 192 N° 3 45885..46053 169 N° 4 46567..47036 470
join(44564..44782,45185..45376,45885..46053,46567..47036)


exon

Literature and cross-references CsPrx54 (orange1.1g018873m/orange1.1t02043)
DNA ref. Citrus sinensis Annotation Project:   chrUn (32239166..32241922) Phytozome 12:   scaffold00043 (44564..47036)
Protein sequence: CsPrx54 (orange1.1g018873m/orange1.1t02043)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (323)
PWM (Da):   %s   37949.16 (35172.7)  
PI (pH):   %s   6.74 (6.74) Peptide Signal:   %s   cut: 27 range:27-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLRYLLAAALVVAFVLEGSSPAQAQLSPFFYSSTCPNVTNIIREVLKNAFLSDIRIGASLIRLHFHDCFVNGCDASILLDNTTTIVSEKFAGPNINSARGFEVVDDMKAAVERACPGVVSCADILTIAAEESVALSGGPSWTNLLGRRDSRTANRTLANENLPGPNNTLTRLKDRFRNVGLNDNFDLVALSGAHTFGRAQCRTFSDRLFNFNNTGNPDPTLNTTLLQQLRQLCPQGGNGSVLTNLDVTTPDLFDNKYFFNLQIRKGLLQSDQELFSTPGADTAAIVNVFSSNQAAFFQSFVISMIRMGNLRPLTGNQGEIRLNCRRVNGNSNIETRSSSEGDLISSF*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCTTCGTTATCTTCTTGCAGCTGCTCTTGTAGTTGCATTTGTGCTTGAGGGATCATCACCAGCTCAAGCTCAACTTTCTCCCTTTTTTTATTCTTCCACATGCCCTAATGTA
ACCAACATAATTCGGGAGGTGCTTAAGAATGCTTTCTTGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTAAT
GTAATCAATCTCTACTCTTTA
ATTTTTCTTCTTCTTCAATTAATATTTTAAAACATGAATTAAGGTCCTCTCCTAATCTGAATTCTGCATAGTATTTTTAAAAATTTTGTGTAACATGCCTATTATTAGTAGCATATGATT
GAACTATAACTACATACACTTATATCCTTAACTTCTAATAATCACAATTAAACTCGGAAAAAGCTTACGTCACGAGGATATCCTGGTTTTAAAAACTTATTATACAATAAGAAAATTTGT
ATATATGTGTATGTTTATCCAAAAAGAAAATGCACAAATATTCATTATTTTTCTTAATCGTAAGATAAGAAGAATCTACCTAATTATTAAATTAACGATACAACAGCAGTTGATCAGAAA
GAGTTTTTGACGTTATTTCAGGGCTGTGATGCATCGATTTTGCTGGACAATACTACTACCATAGTGAGCGAGAAATTTGCTGGGCCAAATATTAATTCGGCGAGGGGTTTTGAAGTTGTT
GATGACATGAAAGCTGCCGTTGAAAGGGCCTGTCCAGGCGTTGTTTCCTGTGCTGATATTCTTACTATTGCAGCTGAAGAATCTGTTGCTCTG
GTATATGTGAATTTCTATTAACAACTC
ATCATCTTGCTCGACTACATATTTTAAACTTAAAAGTGATTAAATTTCTAAGGTATCAGAGAGTAAGTTTGACTTTACATTCGTGTTGGAATTTTCAGACCCTGAGTACTTTAACTAGAT
GAATCCACAGTCCACCGACGTTACCATGTTGACTTCGTGATAGTGCCTGAACAAACTTCACCGTATGAAAAGGGAAGGCTTCTCCTTCCCCCCANNNNNNNNNNNNNNNNNNNNNNGTGA
TGAGATTCAAGGAGGACACATCAGTTTTACGTGTTGGGTTCCAGTATATATTTTGAAAATTTTAAAAAAAAAATATCATCTTTATATGATACAGTCTGGTTGAACCGTTCACTCAAAATT
GTAACGTCGGGAAAGTGCTAATTTTGGGTGCAACAAGACCAATTTCTGATTTTAGTTAAATTTGCTTATTATGCATCTCTCAAGTGATGCTTTTGACTAATGATCGTGGTTTTGGTAACA
GTCAGGGGGTCCTTCATGGACAAATCTATTGGGAAGAAGAGACAGCAGAACCGCAAACAGGACTCTTGCAAATGAAAATCTTCCAGGACCGAACAATACTCTTACGAGGCTCAAAGATAG
ATTCAGAAATGTTGGCCTCAACGATAATTTTGATCTTGTTGCACTCTCCG
GTAATATTTGCTTTTACGCCCTTTGACTTGAGTACAAACAGACCTTGGAGTCTTTTGGGATAAAGCAGTA
TTGGAGCCAGAATTAGAAATCTGGAGGTGGAAAATTTTTTAATGCCAATACTGAGTCTTGAAATCTTAGAGATAGTTTAAATGTTGAATATCTTATTTAAAAAGAAAAAAATAAATTTTG
ATAAGGATGTCTCATCCACTAAATATCAATTTTTTTCTCATTATTACTCTTACTAAGACGACCACCGACACAAAGCACATTCATACTCTACAGCACCTAGGAGGCTTGACTGAATATCCT
AATGATGCGAAGAAACTGTGTTTTAAAGTTTGACATTGGTGATTAGGAATATGTTAAAACGTTTGACAAATTTACTCCCCTTAATCACATCATGAAATTTGAATTGCTTCCCAAGAGAAC
CACCATAATGAAACTCAATTATTATCCTTAATTTGTATGAATTTGAGTAAAAATAACAAAGATTGGCTATGCATGTTTTTCAGGAGCTCACACATTTGGAAGGGCTCAGTGCCGAACTTT
TAGCGATAGGTTATTCAATTTCAACAACACTGGCAATCCAGACCCAACACTTAACACAACCCTCTTACAACAACTTAGGCAACTATGCCCACAAGGTGGAAACGGCAGCGTTCTAACTAA
TCTGGATGTCACAACACCTGATTTGTTTGACAACAAATACTTCTTCAATCTTCAAATCCGCAAGGGCCTTCTGCAGAGTGATCAAGAATTGTTTTCGACTCCCGGTGCCGATACCGCCGC
CATTGTCAATGTCTTTAGTAGCAACCAGGCTGCTTTCTTTCAAAGCTTTGTGATTTCAATGATAAGAATGGGGAATTTGAGACCATTGACAGGCAATCAAGGGGAGATTAGATTGAACTG
CAGGAGGGTCAATGGAAACAGTAATATAGAAACCAGATCATCGTCAGAGGGTGATCTGATCAGCTCTTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCTTCGTTATCTTCTTGCAGCTGCTCTTGTAGTTGCATTTGTGCTTGAGGGATCATCACCAGCTCAAGCTCAACTTTCTCCCTTTTTTTATTCTTCCACATGCCCTAATGTA
ACCAACATAATTCGGGAGGTGCTTAAGAATGCTTTCTTGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTAAT
GGCTGTGATGCATCGATTTTG
CTGGACAATACTACTACCATAGTGAGCGAGAAATTTGCTGGGCCAAATATTAATTCGGCGAGGGGTTTTGAAGTTGTTGATGACATGAAAGCTGCCGTTGAAAGGGCCTGTCCAGGCGTT
GTTTCCTGTGCTGATATTCTTACTATTGCAGCTGAAGAATCTGTTGCTCTG
TCAGGGGGTCCTTCATGGACAAATCTATTGGGAAGAAGAGACAGCAGAACCGCAAACAGGACTCTTGCA
AATGAAAATCTTCCAGGACCGAACAATACTCTTACGAGGCTCAAAGATAGATTCAGAAATGTTGGCCTCAACGATAATTTTGATCTTGTTGCACTCTCCG
GAGCTCACACATTTGGAAGG
GCTCAGTGCCGAACTTTTAGCGATAGGTTATTCAATTTCAACAACACTGGCAATCCAGACCCAACACTTAACACAACCCTCTTACAACAACTTAGGCAACTATGCCCACAAGGTGGAAAC
GGCAGCGTTCTAACTAATCTGGATGTCACAACACCTGATTTGTTTGACAACAAATACTTCTTCAATCTTCAAATCCGCAAGGGCCTTCTGCAGAGTGATCAAGAATTGTTTTCGACTCCC
GGTGCCGATACCGCCGCCATTGTCAATGTCTTTAGTAGCAACCAGGCTGCTTTCTTTCAAAGCTTTGTGATTTCAATGATAAGAATGGGGAATTTGAGACCATTGACAGGCAATCAAGGG
GAGATTAGATTGAACTGCAGGAGGGTCAATGGAAACAGTAATATAGAAACCAGATCATCGTCAGAGGGTGATCTGATCAGCTCTTTCTAA

Retrieve as FASTA