Entry information : CsPrx25 (orange1.1g019278m/Cs3g21730)
Entry ID 8898
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx25 (orange1.1g019278m/Cs3g21730)
Name (synonym) CsPrx25 (orange1.1g019278m/Cs3g21730)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx25
start..stop
S start..stop
CclPrx23 706 0 1..343 1..343
PtPrx67 485 1e-173 1..342 1..350
NtPrx15 465 6e-166 1..342 1..354
FvPrx01 464 2e-165 1..333 1..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 960881..961120 240 N° 2 962449..962634 186 N° 3 963903..964508 606  
join(960881..961120,962449..962634,963903..964508)


exon

Literature and cross-references CsPrx25 (orange1.1g019278m/Cs3g21730)
DNA ref. Citrus sinensis Annotation Project:   chr3 (24555950..24559647) Phytozome 12:   scaffold00002 (960881..964508)
Protein sequence: CsPrx25 (orange1.1g019278m/Cs3g21730)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (317)
PWM (Da):   %s   37664.3 (34925.8)  
PI (pH):   %s   8.39 (8.56) Peptide Signal:   %s   cut: 27 range:27-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATASASSFISLLLISSLLLASFTEAQKPPVAKGLSWTFYDQSCPKLESIVRKQIQNALKKDIGLAAGLIRIHFHDCFVQGCDGSVLLEGSTSEQNARPNLSLRKEALKFVDDLRARVHKECGRVVSCADILALAARDSVALSGGPNYDLPLGRRDSKTFATVVNLPSPFSNTTVILNDFREKTFNARETVALSGGHTVGLAHCPAFTNRLYPKQDPTLDKTFANNLKKTCPTSDSNNTTVFDIRSPNVFDNKYYVDLMNRQGLLTSDQDLYTDKRTRSIVTSFAVDQSLFFQEFANSMIKMSQLSVLTGKQGEIRAKCSVKNSNNLASVVEDVIEEAWSGII*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACTGCTTCAGCTTCTTCTTTCATTTCTCTTCTTTTGATATCTTCTCTTTTGCTTGCTTCTTTCACTGAGGCACAAAAGCCCCCAGTAGCGAAAGGTCTCTCATGGACTTTTTAT
GACCAGAGCTGTCCCAAGCTTGAATCCATTGTCAGAAAACAGATCCAAAATGCCCTGAAAAAAGATATCGGCCTAGCTGCTGGCTTGATTCGCATCCATTTCCACGATTGCTTCGTTCAG
GTAAAAGAAAAAGAAAATGATACCTCAATTAAGCTGGTGCATCACTTATTTCATGGTGTTAATGCGTTTTTAATAAATGCCCTTTTATTTAAAATGGTGATCATCATTAGTTGATCATTT
CTTGATTTGAAAAAAAAAAAAGCCTAAGCACGTTTCTAACTCATGCGTCTTTTTTTTTTTTGAGAAATAAAAAATAATAATACAATGTCTCCTCTAACGAAATTGTCTAAAAAAGAACAC
AAGAATTTTCAAGCTAAAGGTCATATTTCCCCTTTGGACAATTATCTAGCTTGTCCCCATACGTATTGTAAAATATGACCTAAAAGGTCTATATTCTTAATTTTGTAGCAGTTGAATACT
TGAATCTAATTTTTTAAGGGTAAAAAATATTTGTGTCTGATATAAAGTAAAACCAAAACAAATTTGAGGATGCGCAACACATGAAAAAGTAGAAAATAATTAATAAATAGGAAAAAAAAA
AAGAAAACCATGTCGTTTGACTAAATTGATTCAAATTTCCCTAATATTTTAAAACAGATCTAAACTCTCTTAACTTTTTTTTTTTCACTTATCTTATCATTTTGACATTGGAGGTTATTT
GGTGTTGGGAATATCAGTGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAATTATTAGAAAAACAAAGAGAATTGTCCTAGTTTTTC
AATTAATTCTGATTTTTTTCCAGAATTAATTGAAAAATTAAATGCAAAATAAACATATATATACTATTTTTTGGAGAATAATAATAAGAGGGTTGTGTGTGTATATATTGCATTAAATTA
TTCAATAAATTCGGAATTTTTTTTTCAAAATTAACTAAAAAATTATAACAACTCCCCTACTGTTTNNNNNNNNNNNNNNNNNNNNNCTTGAAATTAATTATGACTAATAAATTATTCAAT
TAATTAAATTATTAAAGATATTCATATTCTCAATATCAAATAACTATTAAGCTGAAGGTACAGTGGTAAGATCAGTAAAATTTGACACTCAAGGGGATTATTGGATGTATTTTTAAAACA
TCAGGAAGATTTTGATTAGTTTAATTAAATGACAATGAGTTCAACGCCTTTTTCGTTACTACATATATTATAACATGAATATTATGGATATTTTTTTTAAACAAAAAAATTAATTGGGTA
GATTGCTCAAACCTAGAGACTAAAGGGGCCATAATTTTACAACTTTCTTTGGGTTTTTATAGGATGGTTGCCTTTTAAAAAGTCTTTTGTTTTTTTTTTTTTTTGACAAATTTAGTGAAA
CTTTGCAGGGATGTGATGGATCAGTGTTGCTAGAGGGATCAACTAGTGAGCAAAATGCACGTCCAAACCTAAGCTTAAGGAAAGAGGCTTTAAAATTTGTAGACGATCTTCGTGCTCGTG
TTCACAAGGAGTGTGGCAGAGTTGTTTCTTGTGCTGATATTCTTGCCCTTGCTGCTCGCGATTCTGTTGCCTTG
GTATTTATCTTCATTTCTTCTTTCACTCTTTTTGCTTTTCTAGTCT
CAAATCAGGACTTTAACTAACGAGCAAAACAACGTTATTGTTTGATGTGACCCCTTTTTTAAAAGAAGAAAAATTTAGTCATTCATTTATACATCCCATAATATCTAATGAAAATGTCAA
AGTTGTTAGATCTACCCAAGCCAGGAAAAAGGAGTCGGGTGGTCGGCCAATTAATTAATACCTATTTATGATTAAATGGTCATCTGCACTTATCCGATTATATAGATCCATATTTAATAA
CAATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCTTTTTTCTCTGCTATCATATAATATTATAATAATAATTTATCTTATCATTTTGTCCTCTTTTTTTCCAAATTTGTGCTCCAAATATTAGCGCTCATAGACATAACATACGATC
AATTCATTGGTGTTGATGGCAGTCTGGAGGGCCGAATTACGACCTACCATTGGGAAGGCGAGACAGCAAAACATTCGCAACAGTGGTAAATCTGCCATCACCGTTCAGCAACACCACCGT
GATCCTCAACGATTTCCGAGAAAAAACCTTCAACGCCAGGGAAACCGTGGCCCTCTCCGGCGGGCACACCGTTGGGCTAGCTCACTGCCCTGCATTTACCAATCGCCTCTATCCCAAACA
AGACCCCACACTGGACAAAACATTCGCCAACAATCTCAAAAAGACATGCCCCACTTCGGATTCCAACAACACCACCGTCTTCGACATCCGGTCCCCGAACGTGTTCGACAACAAGTACTA
CGTTGACTTGATGAACCGACAGGGGTTGCTGACGTCGGACCAGGATCTTTACACGGACAAGAGAACGAGGAGCATTGTCACGAGCTTTGCTGTGGACCAGTCACTCTTCTTTCAAGAGTT
TGCCAATTCGATGATAAAGATGTCGCAGTTGAGTGTGCTCACGGGGAAGCAAGGAGAGATTAGAGCCAAGTGCTCCGTCAAGAATTCCAATAATTTGGCTTCTGTTGTTGAGGATGTAAT
TGAAGAGGCTTGGTCTGGGATTATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACTGCTTCAGCTTCTTCTTTCATTTCTCTTCTTTTGATATCTTCTCTTTTGCTTGCTTCTTTCACTGAGGCACAAAAGCCCCCAGTAGCGAAAGGTCTCTCATGGACTTTTTAT
GACCAGAGCTGTCCCAAGCTTGAATCCATTGTCAGAAAACAGATCCAAAATGCCCTGAAAAAAGATATCGGCCTAGCTGCTGGCTTGATTCGCATCCATTTCCACGATTGCTTCGTTCAG
GGATGTGATGGATCAGTGTTGCTAGAGGGATCAACTAGTGAGCAAAATGCACGTCCAAACCTAAGCTTAAGGAAAGAGGCTTTAAAATTTGTAGACGATCTTCGTGCTCGTGTTCACAAG
GAGTGTGGCAGAGTTGTTTCTTGTGCTGATATTCTTGCCCTTGCTGCTCGCGATTCTGTTGCCTTG
TCTGGAGGGCCGAATTACGACCTACCATTGGGAAGGCGAGACAGCAAAACATTC
GCAACAGTGGTAAATCTGCCATCACCGTTCAGCAACACCACCGTGATCCTCAACGATTTCCGAGAAAAAACCTTCAACGCCAGGGAAACCGTGGCCCTCTCCGGCGGGCACACCGTTGGG
CTAGCTCACTGCCCTGCATTTACCAATCGCCTCTATCCCAAACAAGACCCCACACTGGACAAAACATTCGCCAACAATCTCAAAAAGACATGCCCCACTTCGGATTCCAACAACACCACC
GTCTTCGACATCCGGTCCCCGAACGTGTTCGACAACAAGTACTACGTTGACTTGATGAACCGACAGGGGTTGCTGACGTCGGACCAGGATCTTTACACGGACAAGAGAACGAGGAGCATT
GTCACGAGCTTTGCTGTGGACCAGTCACTCTTCTTTCAAGAGTTTGCCAATTCGATGATAAAGATGTCGCAGTTGAGTGTGCTCACGGGGAAGCAAGGAGAGATTAGAGCCAAGTGCTCC
GTCAAGAATTCCAATAATTTGGCTTCTGTTGTTGAGGATGTAATTGAAGAGGCTTGGTCTGGGATTATCTAA

Retrieve as FASTA