Entry information : CsPrx24 (orange1.1g019638m/Cs3g20770)
Entry ID 8901
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx24 (orange1.1g019638m/Cs3g20770)
Name (synonym) CsPrx24 (orange1.1g019638m/Cs3g20770)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx24
start..stop
S start..stop
CclPrx24 653 0 1..338 1..329
GaPrx08 457 2e-163 9..338 9..327
GhPrx35 456 6e-163 9..338 9..327
CpapPrx39 451 1e-160 1..338 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 293330..293560 231 N° 2 293062..293244 183 N° 3 292805..292970 166 N° 4 292251..292687 437
complement(join(292251..292687,292805..292970,293062..293244,293330..293560))


exon

Literature and cross-references CsPrx24 (orange1.1g019638m/Cs3g20770)
DNA ref. Citrus sinensis Annotation Project:   chr3 (23748361..23750119) Phytozome 12:   scaffold00002 (293560..292251)
Protein sequence: CsPrx24 (orange1.1g019638m/Cs3g20770)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (315)
PWM (Da):   %s   36215.56 (33557.0)  
PI (pH):   %s   5.93 (5.24) Peptide Signal:   %s   cut: 24 range:24-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLNFKSPKALVFALIIIYNLLAARTVSSQGQLQVGFYSKTCPNAESIVSSVTQKTFERDPGSAAVLLRLQFHDCYVEGCDASILIDNGEEGERKASGNLGVGGFEIIEEAKAKLEGICPGVVSCADIVALAARDGVALVKGPFYEVPTGRRDGKVSSKSLADNLPEVDDSIQLLKSKFRQKGLSDRDLVLLSGGGHTIGLTACFFMQVRLYNFTPGGGSDPAINPEFLKQLKSKCPFQGDPNTRIPLDPVTDFIFDDQIFLNIKNGFAVIASDARLYDDENTKRILESYVSSAVGNSSSSGSLPSFKADFAKAMVKMGNLGVKTGSEGEIRRVCAAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCAATTTTAAAAGTCCAAAGGCCTTAGTTTTTGCTCTCATTATTATCTATAACCTTCTTGCTGCCAGAACTGTTTCATCACAAGGGCAACTCCAAGTTGGCTTCTACTCAAAAACA
TGCCCAAATGCCGAATCCATTGTCAGTTCTGTCACTCAGAAAACCTTTGAGCGTGACCCAGGAAGTGCCGCAGTTTTGCTAAGGCTTCAGTTCCATGACTGCTATGTCGAG
GTTTTTTTT
TTTTTTCTTCTGTGGCACGTGCACAAACACACACACACAATTCCGAAGGATTTTTGCTGATATATTGCTTGTTCAGGGCTGTGACGCATCAATACTGATTGATAACGGTGAAGAAGGAGA
AAGAAAAGCGTCGGGAAACTTAGGAGTTGGTGGTTTTGAGATCATAGAAGAAGCCAAAGCAAAATTGGAAGGTATTTGCCCTGGAGTTGTTTCTTGCGCGGATATTGTGGCTTTGGCTGC
CAGAGATGGTGTGGCTTTG
GTAAAATTTATTATACCGAGAGATTTCACTTATTTGCTTTTGTATTATTATTTTTATTAAAAAAAAAATTCTGCGTTGGTATCTTTGACAGGTTAAAGGGC
CATTTTACGAAGTACCAACCGGCCGTAGGGATGGAAAGGTTTCAAGCAAATCCCTGGCTGATAATTTACCCGAAGTTGATGACTCAATTCAGCTTCTTAAATCTAAATTCAGGCAGAAGG
GTCTTTCTGATAGAGATCTTGTCCTTCTTAGTGGCG
GTATACCGATACACAATCTTTAAGAATCTTTTTGTTGGTTTAGATTGTCTACACACATTTAGAAGTCTATATAATTATGTTATA
ATTAAAGCTACTAAGTTGGTGTTTTATTTTCAGGTGGGCATACGATTGGACTCACTGCTTGCTTCTTCATGCAAGTCCGTCTCTACAATTTCACCCCTGGAGGTGGTTCGGATCCAGCGA
TAAATCCTGAATTCCTGAAGCAACTCAAATCCAAGTGCCCATTTCAGGGCGACCCTAATACCAGAATACCTCTGGATCCGGTGACTGATTTCATATTCGATGATCAGATTTTTTTGAACA
TCAAAAATGGATTTGCTGTGATAGCGTCTGATGCTAGGCTTTATGATGACGAGAACACCAAGCGGATACTTGAATCCTACGTTAGTAGCGCTGTCGGGAATTCTTCTAGCTCTGGGTCAT
TGCCATCTTTCAAGGCTGATTTTGCCAAAGCAATGGTGAAGATGGGCAATCTTGGCGTCAAAACTGGCTCAGAGGGGGAGATTAGACGAGTTTGCGCTGCTGTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCAATTTTAAAAGTCCAAAGGCCTTAGTTTTTGCTCTCATTATTATCTATAACCTTCTTGCTGCCAGAACTGTTTCATCACAAGGGCAACTCCAAGTTGGCTTCTACTCAAAAACA
TGCCCAAATGCCGAATCCATTGTCAGTTCTGTCACTCAGAAAACCTTTGAGCGTGACCCAGGAAGTGCCGCAGTTTTGCTAAGGCTTCAGTTCCATGACTGCTATGTCGAG
GGCTGTGAC
GCATCAATACTGATTGATAACGGTGAAGAAGGAGAAAGAAAAGCGTCGGGAAACTTAGGAGTTGGTGGTTTTGAGATCATAGAAGAAGCCAAAGCAAAATTGGAAGGTATTTGCCCTGGA
GTTGTTTCTTGCGCGGATATTGTGGCTTTGGCTGCCAGAGATGGTGTGGCTTTG
GTTAAAGGGCCATTTTACGAAGTACCAACCGGCCGTAGGGATGGAAAGGTTTCAAGCAAATCCCTG
GCTGATAATTTACCCGAAGTTGATGACTCAATTCAGCTTCTTAAATCTAAATTCAGGCAGAAGGGTCTTTCTGATAGAGATCTTGTCCTTCTTAGTGGCG
GTGGGCATACGATTGGACTC
ACTGCTTGCTTCTTCATGCAAGTCCGTCTCTACAATTTCACCCCTGGAGGTGGTTCGGATCCAGCGATAAATCCTGAATTCCTGAAGCAACTCAAATCCAAGTGCCCATTTCAGGGCGAC
CCTAATACCAGAATACCTCTGGATCCGGTGACTGATTTCATATTCGATGATCAGATTTTTTTGAACATCAAAAATGGATTTGCTGTGATAGCGTCTGATGCTAGGCTTTATGATGACGAG
AACACCAAGCGGATACTTGAATCCTACGTTAGTAGCGCTGTCGGGAATTCTTCTAGCTCTGGGTCATTGCCATCTTTCAAGGCTGATTTTGCCAAAGCAATGGTGAAGATGGGCAATCTT
GGCGTCAAAACTGGCTCAGAGGGGGAGATTAGACGAGTTTGCGCTGCTGTTAATTGA

Retrieve as FASTA