Entry information : CsPrx59 (orange1.1g019976m)
Entry ID 8903
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx59 (orange1.1g019976m)
Name (synonym) CsPrx59 (orange1.1g019976m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx59
start..stop
S start..stop
CclPrx30 669 0 1..333 1..333
PpePrx07 520 0 13..332 14..332
RcPrx16 514 0 8..333 12..335
GhPrx22 514 0 24..333 26..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1561995..1562213 219 N° 2 1561726..1561920 195 N° 3 1561479..1561644 166 N° 4 1560877..1561298 422
complement(join(1560877..1561298,1561479..1561644,1561726..1561920,1561995..1562 213))


exon

Literature and cross-references CsPrx59 (orange1.1g019976m)
DNA ref. Phytozome 12:   scaffold00018 (1562213..1560877)
Protein sequence: CsPrx59 (orange1.1g019976m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (307)
PWM (Da):   %s   34956.15 (32190.8)  
PI (pH):   %s   5.22 (5.22) Peptide Signal:   %s   cut: 27 range:27-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFYSLTSSIAAATIFITLLFSNSQAQLNSSFYATTCPNVTTIVRNALQQAMQSDIRIGASLIRLHFHDCFVNGCDGSVLLDRGGNITQSEKDGGPNTNSARGFGVVDNIKTAVENSCPGVVSCADILALAAESSVSLAGGPSWNVLLGRRDGLRANQSGANSSIPAPIDSLSNLTSKFSAVGLDTTDLVALSGAHTFGRAQCRVFSGRLYNFNGTGNPDPTVNGTYLTTLRQICPQNGNGSALANLDPTTADTFDNNYYTNLQNNQGLLQSDQELFSTNGPAAIVAIVNNFASNQTAFFQQFVQSMINMGNISPLTGSNGEIRADCKKVNGS

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCTATTCGCTCACTTCTTCAATAGCAGCAGCCACCATTTTCATAACATTGTTGTTCAGTAACTCACAGGCTCAACTGAACTCCTCATTTTATGCTACAACATGTCCGAATGTG
ACCACCATTGTGCGCAATGCTCTGCAGCAAGCCATGCAATCCGACATCAGAATCGGCGCCAGCCTCATTCGCCTCCATTTCCACGATTGCTTCGTTAAT
GTAATCAATCATGCTCGAATT
CATAACCTCCATTAATCAATTACAATAATAATTATAATCGTTCTTTGTTTCAGGGGTGTGACGGTTCGGTTTTGTTAGACAGAGGCGGAAACATAACACAGAGCGAGAAAGATGGCGGTC
CTAACACTAATTCGGCCAGAGGGTTTGGTGTTGTCGACAACATCAAGACTGCTGTCGAGAATTCTTGCCCCGGTGTTGTTTCTTGTGCTGACATTCTAGCTCTTGCTGCTGAGTCTTCTG
TCTCTTTG
GTAACTTAATTAGTTAATTAAATATGACTTTAATTTATATTGACCCTATAATTAAGAATAACTAATTCTGTTGATTTTCAGGCAGGAGGCCCTTCATGGAATGTACTATTGG
GAAGGAGGGACGGTTTAAGGGCAAATCAAAGCGGAGCAAATTCCTCTATTCCTGCTCCTATTGACAGCTTAAGCAACCTCACTTCTAAATTCTCTGCCGTTGGTCTAGACACTACCGATC
TTGTTGCTTTATCCG
GTAATCATAAATACACATAGTCGTTTTTAGGTGCGGAAGCTTGTAACTTATAAAGTGCGGATTTAATCTACAACCAGTGTCCTATGCCGCAGTAGGAAAATCGGC
ACTTTATAAGCTAATTTAGGAACATTGTTGCAACTTCAGGAGCAGTATTGATTGTGTGTATGTGCAATTTTGCAGGGGCACATACTTTCGGACGTGCACAATGTCGAGTATTCAGCGGCA
GGCTGTACAATTTCAATGGCACGGGCAACCCAGACCCAACGGTAAACGGAACGTATTTGACAACTCTGCGGCAAATTTGCCCACAAAATGGTAATGGCTCGGCGCTAGCGAATCTCGATC
CCACAACAGCAGATACTTTTGACAATAATTACTACACAAATCTTCAAAACAATCAAGGGCTTTTGCAATCAGACCAAGAGCTATTTTCAACAAATGGTCCTGCTGCTATTGTCGCCATTG
TGAACAATTTTGCTAGCAACCAAACAGCATTTTTCCAACAGTTCGTTCAGTCTATGATTAACATGGGCAATATTAGCCCATTAACGGGGAGCAATGGAGAAATTAGAGCAGATTGTAAGA
AAGTTAATGGAAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCTATTCGCTCACTTCTTCAATAGCAGCAGCCACCATTTTCATAACATTGTTGTTCAGTAACTCACAGGCTCAACTGAACTCCTCATTTTATGCTACAACATGTCCGAATGTG
ACCACCATTGTGCGCAATGCTCTGCAGCAAGCCATGCAATCCGACATCAGAATCGGCGCCAGCCTCATTCGCCTCCATTTCCACGATTGCTTCGTTAAT
GGGTGTGACGGTTCGGTTTTG
TTAGACAGAGGCGGAAACATAACACAGAGCGAGAAAGATGGCGGTCCTAACACTAATTCGGCCAGAGGGTTTGGTGTTGTCGACAACATCAAGACTGCTGTCGAGAATTCTTGCCCCGGT
GTTGTTTCTTGTGCTGACATTCTAGCTCTTGCTGCTGAGTCTTCTGTCTCTTTG
GCAGGAGGCCCTTCATGGAATGTACTATTGGGAAGGAGGGACGGTTTAAGGGCAAATCAAAGCGGA
GCAAATTCCTCTATTCCTGCTCCTATTGACAGCTTAAGCAACCTCACTTCTAAATTCTCTGCCGTTGGTCTAGACACTACCGATCTTGTTGCTTTATCCG
GGGCACATACTTTCGGACGT
GCACAATGTCGAGTATTCAGCGGCAGGCTGTACAATTTCAATGGCACGGGCAACCCAGACCCAACGGTAAACGGAACGTATTTGACAACTCTGCGGCAAATTTGCCCACAAAATGGTAAT
GGCTCGGCGCTAGCGAATCTCGATCCCACAACAGCAGATACTTTTGACAATAATTACTACACAAATCTTCAAAACAATCAAGGGCTTTTGCAATCAGACCAAGAGCTATTTTCAACAAAT
GGTCCTGCTGCTATTGTCGCCATTGTGAACAATTTTGCTAGCAACCAAACAGCATTTTTCCAACAGTTCGTTCAGTCTATGATTAACATGGGCAATATTAGCCCATTAACGGGGAGCAAT
GGAGAAATTAGAGCAGATTGTAAGAAAGTTAATGGAAGCTAG

Retrieve as FASTA