Entry information : CsPrx50 (orange1.1g020050m/orange1.1t02033)
Entry ID 8904
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx50 (orange1.1g020050m/orange1.1t02033)
Name (synonym) CsPrx50 (orange1.1g020050m/orange1.1t02033)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx50
start..stop
S start..stop
CclPrx31 670 0 1..332 1..332
CclPrx111 569 0 25..332 25..331
CsPrx51 505 0 71..332 130..390
GrPrx41 491 1e-176 1..328 1..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2993..3211 219 N° 2 2217..2399 183 N° 3 1555..1717 163 N° 4 670..1103 434
complement(join(670..1103,1555..1717,2217..2399,2993..3211))


exon

Literature and cross-references CsPrx50 (orange1.1g020050m/orange1.1t02033)
DNA ref. Citrus sinensis Annotation Project:   chrUn (32146097..32148638) Phytozome 12:   scaffold00101 (3211..670)
Protein sequence: CsPrx50 (orange1.1g020050m/orange1.1t02033)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (306)
PWM (Da):   %s   35685.03 (32624.4)  
PI (pH):   %s   8.15 (7.70) Peptide Signal:   %s   cut: 27 range:27-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNRSFTKFGGHFLFAIFFVLCLGVKSQLSTNFYSKTCPNVLQIVRREVQKAIKVEMRMAASLIRLHFHDCFVNGCDASVLLDGSDSEKFAAPNRNSARGFEVIDAIKTAVERQCSGVVSCADILAIAARDSVLLSGGPTWKVLLGRRDGLVANQTGANALPSPFEGLNILTAKFAAVGLNITDLVSLSGGAHTIGLAKCAFFSNRLSNFSGTGAPDATMDTSLVSELRSLCANGDGNNTAPLDRNSIDLFDNHYFQNLINNKGLLSSDQILYSSDEAKSTTKSLVESYSSNSNLFFANFVNSMIKMGNVSPLTGTNGEIRKNCRAVNSLTEI*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATAGGTCATTTACGAAGTTCGGTGGTCATTTTCTCTTCGCGATTTTCTTTGTGTTGTGTCTAGGTGTTAAGTCTCAACTAAGTACTAATTTTTACTCGAAAACGTGCCCAAATGTC
CTTCAAATTGTGAGGAGAGAAGTTCAGAAAGCAATCAAAGTTGAAATGAGAATGGCAGCCTCTTTGATCCGACTTCATTTCCATGATTGCTTCGTTAAT
GTGAGTTTAGGCTTTGAAATG
CTTATTGTAGTATCATTAGTAACGTTTTTCTTAAATCTTTAGATTGATGTGCCAAGCATATATCTTAAGTGTTCAAAAGTTACTGTAGATTGTTGGGCACCTGCCTTTAAGCTTATACTA
TTATTAAGTCAAAGTGGTAGTTCAGTATGATCCACAGCATATATATTTGACCTAAATGTCTCCTGCTCGAATATTTTCGAATACAAATTAAATATAATTTGCACATAATTGTATGAGTTG
TTTGGATTTAATTTACGTGACATATCTCAAGAAGACTTGTAAAAAAGAACGAATGATATACCAAACTTAAAAATTATTTTTCAGTTTAATTCATGAGTCAAGACTAACATATTATAGTTT
CATTTTTATTCTTTTTTGGATCAAGTGCTTATATATTCTCAGTTCAAGCAGCTTTAATCTTGCATTGCACGGCTAAAAGTATAGTATACTGTACACTAGTTTATGAATAAATAAAATTTA
TGTATCTTTAATTTTACTATCATTTTTTCCCTAAATTATTCATCATTTGGTAATTATAATTATCATAAACTTGATCTCCTTCTTTGTTATAGGGTTGTGATGCATCAGTGTTATTGGATG
GAAGTGACAGTGAGAAGTTTGCCGCGCCTAACCGGAACTCAGCACGAGGATTTGAAGTTATTGACGCAATAAAAACTGCTGTGGAACGTCAATGCAGTGGAGTTGTATCATGCGCTGATA
TTTTAGCCATAGCTGCAAGAGATTCAGTGCTCTTG
GTAAGTTGGTTGATTAATTGTTCTTCTCATATAGATTCCATGGGACTAAAAGAAATAGAGACATGAGAAACTTGAGACCTTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATCTGAACT
AAATTATCAAGTAGGGACTAAGTCATCTTAGTTCACAGGATTCTACCAATTAATAGATAAAGAATTTTCTTTTTTCATATTCTAATGATATGAGAAAATTAAAATTTTCTCTTTATATTT
GAACTTTATGAGGTTAACTTTTACTTATACAAATACTATGACAATATTTTGCAGAGTGGAGGACCTACATGGAAAGTTCTGCTGGGAAGAAGAGATGGACTGGTGGCAAACCAGACAGGT
GCCAATGCTCTTCCTTCACCATTTGAGGGGCTAAACATTCTCACTGCCAAGTTTGCAGCCGTGGGTCTAAATATTACAGACTTAGTGTCCTTGTCAG
GTAATTTATTTGACCTCTCTATC
ACCATATATTTGTATCAAATCATCATAACTAATTAGCCTTCATTCGGGGTCACTTTAAATTGTAAAGTAATGACATTCTATATAAATTTGGCTCCTCTACTAGTTTAACTTATTTAAAAG
ATCTCGTGAGACATGTGTTTATATTATAATATTTAAAAAGTGTAGATTGAGTCAACTCATCGTTCATACCTCAAATTGTGCTCGTGTCAAACTCAATTTTTTAAAATTCGGCCATATATT
ACCCGTTTTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCATCTATCCGAAATTTTCTCAATGTTTGAAACATATCCCAAAAGTTTGCATTA
GGAATCTCAGGACCCCATTTTGAACTCCCATAATGTGCGAGCTCGGTAATTTTAATGTTTATGTGCAGGTGGTGCTCATACAATTGGACTCGCAAAATGTGCCTTCTTCAGCAATAGACT
ATCCAACTTCTCAGGGACAGGTGCTCCAGACGCTACAATGGACACAAGCTTGGTGTCCGAATTGCGGAGCCTATGTGCTAACGGTGACGGAAACAATACGGCGCCGCTTGATCGGAACTC
GATTGATCTATTTGACAACCATTACTTCCAGAACTTGATCAACAATAAGGGCCTTCTTAGTTCTGATCAAATTCTATACTCTAGTGATGAGGCCAAATCAACTACTAAGAGTCTTGTTGA
AAGCTATAGCAGCAACTCAAATCTTTTCTTTGCTAATTTTGTTAATTCTATGATCAAAATGGGGAATGTAAGTCCACTCACCGGGACTAATGGTGAGATTAGGAAGAACTGCAGGGCAGT
TAATTCCTTAACTGAGATATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATAGGTCATTTACGAAGTTCGGTGGTCATTTTCTCTTCGCGATTTTCTTTGTGTTGTGTCTAGGTGTTAAGTCTCAACTAAGTACTAATTTTTACTCGAAAACGTGCCCAAATGTC
CTTCAAATTGTGAGGAGAGAAGTTCAGAAAGCAATCAAAGTTGAAATGAGAATGGCAGCCTCTTTGATCCGACTTCATTTCCATGATTGCTTCGTTAAT
GGTTGTGATGCATCAGTGTTA
TTGGATGGAAGTGACAGTGAGAAGTTTGCCGCGCCTAACCGGAACTCAGCACGAGGATTTGAAGTTATTGACGCAATAAAAACTGCTGTGGAACGTCAATGCAGTGGAGTTGTATCATGC
GCTGATATTTTAGCCATAGCTGCAAGAGATTCAGTGCTCTTG
AGTGGAGGACCTACATGGAAAGTTCTGCTGGGAAGAAGAGATGGACTGGTGGCAAACCAGACAGGTGCCAATGCTCTT
CCTTCACCATTTGAGGGGCTAAACATTCTCACTGCCAAGTTTGCAGCCGTGGGTCTAAATATTACAGACTTAGTGTCCTTGTCAG
GTGGTGCTCATACAATTGGACTCGCAAAATGTGCC
TTCTTCAGCAATAGACTATCCAACTTCTCAGGGACAGGTGCTCCAGACGCTACAATGGACACAAGCTTGGTGTCCGAATTGCGGAGCCTATGTGCTAACGGTGACGGAAACAATACGGCG
CCGCTTGATCGGAACTCGATTGATCTATTTGACAACCATTACTTCCAGAACTTGATCAACAATAAGGGCCTTCTTAGTTCTGATCAAATTCTATACTCTAGTGATGAGGCCAAATCAACT
ACTAAGAGTCTTGTTGAAAGCTATAGCAGCAACTCAAATCTTTTCTTTGCTAATTTTGTTAATTCTATGATCAAAATGGGGAATGTAAGTCCACTCACCGGGACTAATGGTGAGATTAGG
AAGAACTGCAGGGCAGTTAATTCCTTAACTGAGATATGA

Retrieve as FASTA