Entry information : CsPrx35 (orange1.1g020451m/Cs5g34200)
Entry ID 8909
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx35 (orange1.1g020451m/Cs5g34200)
Name (synonym) CsPrx35 (orange1.1g020451m/Cs5g34200)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx35
start..stop
S start..stop
CclPrx101 667 0 1..326 1..326
RcPrx31 475 4e-170 1..326 1..335
PtPrx80 473 2e-169 1..326 1..337
PtPrx70 468 2e-167 1..326 1..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 136552..136764 213 N° 2 135875..136066 192 N° 3 135595..135760 166 N° 4 134768..135177 410
complement(join(134768..135177,135595..135760,135875..136066,136552..136764))


exon

Literature and cross-references CsPrx35 (orange1.1g020451m/Cs5g34200)
DNA ref. Citrus sinensis Annotation Project:   chr5 (35069892..35071889) Phytozome 12:   scaffold00248 (136764..134768)
Protein sequence: CsPrx35 (orange1.1g020451m/Cs5g34200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (301)
PWM (Da):   %s   35738.94 (32790.5) Transmb domain:   %s   i2-24o
PI (pH):   %s   6.86 (6.74) Peptide Signal:   %s   cut: 26 range:26-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGHIIFSSCTIPFFFILCLFPFVSSFPYSQFDGSCPYLPMIVRNGVWDAFRKDNRIAASLLRLHFHDCFIIGCDASILLDDTNDFKGEKNAVPNRNSARGYEVIDSIKADVEKACPLSISCADILALAAREAVVLSGGPYWQVQLGRRDGLTASESAANAQLPSPFEPLDNIVAKFLAKGLDIKDVVVLSGAHTIGFAQCITFKNRLFNYKGSGQPDPALDSSALPDLKTICPNQDSSNSNLAPLDSPSAYRFDNVYYTNLVRRTGLLESDQALMGDPRTAALVKAYSMNPYLFYNDFATSMVKMSNIGILAGKDGQIRKSCRFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCACATTATTTTCTCAAGCTGCACTATTCCCTTCTTTTTCATCCTGTGTTTGTTTCCCTTTGTTTCCTCTTTTCCTTACAGCCAGTTTGATGGATCGTGCCCATACTTGCCAATG
ATTGTTAGGAATGGTGTTTGGGATGCTTTTAGGAAAGATAACAGAATAGCTGCATCCCTTCTCCGGTTGCACTTTCATGATTGTTTCATTATT
GTAACTATATACTCTCCAACTTATTAT
TTCTTCTTAGCATTATCCTCAAAACCAATTCGGAATTTTATAAGATAGCGTACAAAATAAGATTTTTTTAGTTGCTAGGGTGTTTACTGATGATCAGGTTTGTGGAAAGACTGAAGAAAC
CTGAAGTGCTGCCAAAACTATGTTTTGTTAAGAGTGAAAGTGATGTTATTAGACATGCTATGTTTAGTACTTTTTAGATTTTGTTTTTCTTTCAGCCTGGGACCCATTAGTTTAGAAGAA
TTTCCTATTATACACATAACATGGAAATTTTGAGTCAGTTTTTATATTATCTGCAATGTTCATGATTTAGCACAAACAACATCTAATACTAAAAATGCTAAAGTGGTTCAATGAATGTTA
AAAGGAAGAAGTAAGATTAGAGTTATCGCAGTTTTGTTTTTGAATTTACTTCCAAGCAGTACAGTTTGAGTTCAAAGTTGTACTCTTTTGGTACACAGGGTTGTGATGCCTCAATTCTTC
TGGATGACACGAATGATTTCAAGGGGGAGAAAAACGCTGTGCCAAATCGCAATTCTGCTCGAGGATACGAAGTCATTGACAGTATAAAAGCAGATGTTGAAAAAGCTTGCCCATTAAGTA
TTTCTTGTGCTGATATTTTGGCTCTTGCAGCCAGAGAGGCTGTTGTGCTG
GTAATTAAACATATTCATAACTTAAAATCTATTTAACTGTTGTCTCAGGACTCCAGCCGAAATGAACTCT
TTCTTCAACTGACTTTTCCATCAAATCCTAATATTCTGGTTTAGTCAGGAGGGCCCTACTGGCAAGTTCAATTAGGCCGTAGAGATGGATTAACAGCAAGTGAGTCCGCAGCTAATGCAC
AGTTGCCATCACCTTTTGAGCCTCTGGATAACATTGTTGCCAAGTTCTTAGCAAAGGGCCTTGACATCAAGGATGTTGTAGTCCTCTCAG
GTTTTGATTCTTCTGCTTTCTTTTTCATTT
TAGTTGTTATTGTTTTAAAATCTCATGATTTCTAGATAAAAAGTCGATTCAAGAAAGAATTGTGCTTCATTGGCATTCCATCTGAAATGAGTGATCATTCCTTGCATTTGAAAGCATAAA
GGTTCTTACACTGGTCGAGCCATTTAAGAGAAAGCATGAGTAAGAGAACATAAATGATACTAAAGAGTCCTAATTTAAACTTAGCTTATTTATTTGAAAATCTTTTGTTTTGGCCCTCTC
AATTTACAGGATTTGTAGTTTCTTCATTTGGCCCCACTAAACCAAAATTCTATTTCACCCCCTGCATAATATTCATCTCAATGACTAGGTGATGTCTCAAATACAAATAATTAACATAAA
CCTTTGGCTACTTGGTTCTTTTTACAGGAGCACACACCATAGGTTTTGCTCAATGCATCACCTTCAAGAACAGACTCTTCAACTACAAAGGGTCTGGCCAGCCAGACCCTGCGCTCGATT
CTTCTGCACTGCCGGATTTGAAAACCATATGTCCAAACCAGGATTCGTCAAACAGCAACCTTGCTCCTCTTGACTCCCCAAGTGCATACAGATTTGACAATGTGTACTACACTAACCTCG
TTAGAAGGACAGGCCTTCTCGAATCCGATCAAGCATTAATGGGGGATCCTAGGACTGCTGCATTGGTTAAGGCTTATAGCATGAACCCATATCTATTCTACAATGATTTTGCTACATCAA
TGGTGAAGATGAGTAATATTGGGATACTCGCTGGGAAAGATGGGCAAATCAGGAAGTCCTGTAGGTTTGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCACATTATTTTCTCAAGCTGCACTATTCCCTTCTTTTTCATCCTGTGTTTGTTTCCCTTTGTTTCCTCTTTTCCTTACAGCCAGTTTGATGGATCGTGCCCATACTTGCCAATG
ATTGTTAGGAATGGTGTTTGGGATGCTTTTAGGAAAGATAACAGAATAGCTGCATCCCTTCTCCGGTTGCACTTTCATGATTGTTTCATTATT
GGTTGTGATGCCTCAATTCTTCTGGAT
GACACGAATGATTTCAAGGGGGAGAAAAACGCTGTGCCAAATCGCAATTCTGCTCGAGGATACGAAGTCATTGACAGTATAAAAGCAGATGTTGAAAAAGCTTGCCCATTAAGTATTTCT
TGTGCTGATATTTTGGCTCTTGCAGCCAGAGAGGCTGTTGTGCTG
TCAGGAGGGCCCTACTGGCAAGTTCAATTAGGCCGTAGAGATGGATTAACAGCAAGTGAGTCCGCAGCTAATGCA
CAGTTGCCATCACCTTTTGAGCCTCTGGATAACATTGTTGCCAAGTTCTTAGCAAAGGGCCTTGACATCAAGGATGTTGTAGTCCTCTCAG
GAGCACACACCATAGGTTTTGCTCAATGC
ATCACCTTCAAGAACAGACTCTTCAACTACAAAGGGTCTGGCCAGCCAGACCCTGCGCTCGATTCTTCTGCACTGCCGGATTTGAAAACCATATGTCCAAACCAGGATTCGTCAAACAGC
AACCTTGCTCCTCTTGACTCCCCAAGTGCATACAGATTTGACAATGTGTACTACACTAACCTCGTTAGAAGGACAGGCCTTCTCGAATCCGATCAAGCATTAATGGGGGATCCTAGGACT
GCTGCATTGGTTAAGGCTTATAGCATGAACCCATATCTATTCTACAATGATTTTGCTACATCAATGGTGAAGATGAGTAATATTGGGATACTCGCTGGGAAAGATGGGCAAATCAGGAAG
TCCTGTAGGTTTGTTAACTAA

Retrieve as FASTA