Entry information : CsPrx09 (orange1.1g021592m/Cs1g22960)
Entry ID 8920
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-11-30 (Qiang Li)
Peroxidase information: CsPrx09 (orange1.1g021592m/Cs1g22960)
Name (synonym) CsPrx09 (orange1.1g021592m/Cs1g22960)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx09
start..stop
S start..stop
CclPrx59 642 0 1..310 20..329
NtPrx31-1A 510 0 1..310 17..327
EgrPrx124 509 0 1..310 16..325
EcamPrx124 502 0 11..310 9..308
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5881..6048 168 N° 2 5397..5588 192 N° 3 5140..5302 163 N° 4 4619..5028 410
complement(join(4619..5028,5140..5302,5397..5588,5881..6048))


exon

Literature and cross-references CsPrx09 (orange1.1g021592m/Cs1g22960)
DNA ref. Citrus sinensis Annotation Project:   chr1 (25630569..25632244) Phytozome 12:   scaffold04278 (6048..4619)
Protein sequence: CsPrx09 (orange1.1g021592m/Cs1g22960)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   311
PWM (Da):   %s   33843.87  
PI (pH):   %s   6.73
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLSTLVSCQLDYKYYDDTCPSLTRIVRYGVWSAISNETRMAASLLRLHFHDCFVKGCDGSVLLDDTSTTKGEKNAFPNRNSARGFEVIDAIKANLEKACPATVSCTDILTLVAREAVFLGGGPFWAVPLGRRDGLTASESEANNLPSPFEPLQNITAKFTARGLDLKDVVVLSGGHTIGFAQCLSFKNRLFDFSGSGKPDPTLDASLLQSLQSTCPSQADSDTKLVALDSVTTNKFDNIYFQNLVNKSGLLQSDQALMGDNRTAAMVQYYSKYPYFFSKDFGASMVKMANIGVLTGQDGEIRKNCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTGAGTACTCTAGTGTCCTGTCAACTTGATTATAAATATTATGACGACACTTGCCCCAGCTTGACAAGAATAGTTCGATATGGGGTTTGGTCCGCCATATCAAATGAAACAAGG
ATGGCAGCCTCTCTCTTGCGGCTTCACTTCCATGATTGTTTTGTCAAA
GTAATTTTGGTTACCCTTTTCAAGTTTAGCCATTTCAGTTATAAGATCTTTTATGTTAATTTTGTTATGATT
ATGTTCAAGCTAACTTAGGGGAAAACATTAAGAAAGTAGACAATAAGAGATGCATGGTTATGTATTCTCATGAACTTCAGAGACAAGAAAGTTAAAGCTACTTATAAACTCCTGTGCTAC
TTTATCAATCTTATAATAATGTTGACAACCCATCATTGTAGACTTTTCTGGTCTGCGGAAGCTTACTGCAGAAACCATTCTTTTTCACTTCTTGATGCAGGGATGCGACGGTTCTGTACT
GCTTGATGATACCAGCACAACTAAAGGGGAGAAAAATGCGTTTCCTAATCGAAACTCAGCCAGAGGTTTTGAGGTCATTGACGCTATTAAGGCTAATTTGGAGAAAGCTTGTCCAGCCAC
TGTTTCTTGTACTGATATATTAACTCTTGTGGCAAGAGAGGCTGTATTTCTA
GTACGAAAATCCTCCCCCGTAACTACTCTTTCACATTGTTTTGGCATTATTGTTCCTGAATTATAATT
ATCATTTTCTTAATATATTTTCTCAGGGTGGTGGTCCGTTTTGGGCTGTACCCTTAGGTCGCCGAGATGGCTTAACAGCAAGTGAGAGCGAAGCTAACAATCTGCCATCTCCTTTCGAAC
CTTTACAGAACATCACCGCAAAGTTCACTGCGAGGGGTCTTGATCTGAAGGATGTTGTTGTGCTCTCAG
GTTTGCCTTCCCATATCACAGTCACTTCTCCAAATCATGACATTCCATATC
TGAAATATAAGGAGCAGTAACCTTTTCCTTTATAACACAGTCGTGTGAAATGAACGACAGGTGGGCACACAATTGGCTTTGCTCAATGCTTGTCATTCAAGAATAGGCTATTCGACTTCA
GTGGCTCTGGAAAGCCTGATCCAACACTTGATGCTTCACTACTACAAAGTCTGCAAAGCACGTGTCCCAGTCAAGCTGATTCTGATACAAAACTGGTTGCTCTGGATTCTGTCACTACAA
ACAAGTTCGACAATATTTACTTCCAAAATCTGGTGAACAAATCTGGGTTACTCCAGTCAGATCAAGCTCTCATGGGAGACAACAGAACTGCTGCAATGGTTCAATATTACAGCAAGTACC
CTTACTTTTTCTCCAAAGATTTTGGTGCATCAATGGTGAAGATGGCCAACATAGGTGTATTAACTGGGCAAGATGGGGAGATAAGGAAGAATTGTCGCGTCGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTGAGTACTCTAGTGTCCTGTCAACTTGATTATAAATATTATGACGACACTTGCCCCAGCTTGACAAGAATAGTTCGATATGGGGTTTGGTCCGCCATATCAAATGAAACAAGG
ATGGCAGCCTCTCTCTTGCGGCTTCACTTCCATGATTGTTTTGTCAAA
GGATGCGACGGTTCTGTACTGCTTGATGATACCAGCACAACTAAAGGGGAGAAAAATGCGTTTCCTAATCGA
AACTCAGCCAGAGGTTTTGAGGTCATTGACGCTATTAAGGCTAATTTGGAGAAAGCTTGTCCAGCCACTGTTTCTTGTACTGATATATTAACTCTTGTGGCAAGAGAGGCTGTATTTCTA
GGTGGTGGTCCGTTTTGGGCTGTACCCTTAGGTCGCCGAGATGGCTTAACAGCAAGTGAGAGCGAAGCTAACAATCTGCCATCTCCTTTCGAACCTTTACAGAACATCACCGCAAAGTTC
ACTGCGAGGGGTCTTGATCTGAAGGATGTTGTTGTGCTCTCAG
GTGGGCACACAATTGGCTTTGCTCAATGCTTGTCATTCAAGAATAGGCTATTCGACTTCAGTGGCTCTGGAAAGCCT
GATCCAACACTTGATGCTTCACTACTACAAAGTCTGCAAAGCACGTGTCCCAGTCAAGCTGATTCTGATACAAAACTGGTTGCTCTGGATTCTGTCACTACAAACAAGTTCGACAATATT
TACTTCCAAAATCTGGTGAACAAATCTGGGTTACTCCAGTCAGATCAAGCTCTCATGGGAGACAACAGAACTGCTGCAATGGTTCAATATTACAGCAAGTACCCTTACTTTTTCTCCAAA
GATTTTGGTGCATCAATGGTGAAGATGGCCAACATAGGTGTATTAACTGGGCAAGATGGGGAGATAAGGAAGAATTGTCGCGTCGTGAACTAG

Retrieve as FASTA