Entry information : GmPrx103 (Glyma01g39080.1)
Entry ID 8933
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-18 (Christophe Dunand)
Peroxidase information: GmPrx103 (Glyma01g39080.1)
Name (synonym) GmPrx103 (Glyma01g39080.1)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx103
start..stop
S start..stop
GmPrx203 634 0 1..327 1..327
LjPrx36 558 0 11..327 10..326
MtPrx52 548 0 1..327 1..326
MtPrx58 544 0 1..327 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 51065305..51065523 219 N° 2 51065626..51065817 192 N° 3 51066213..51066375 163 N° 4 51066648..51067057 410
join(51065305..51065523,51065626..51065817,51066213..51066375,51066648..51067057 )


exon

Literature and cross-references GmPrx103 (Glyma01g39080.1)
DNA ref. Phytozome 12:   Gm01 (51065305..51067057)
Protein sequence: GmPrx103 (Glyma01g39080.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (301)
PWM (Da):   %s   35976.17 (32755.6) Transmb domain:   %s   i9-31o
PI (pH):   %s   7.22 (7.24) Peptide Signal:   %s   cut: 27 range:27-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEFKSNNMLLFVSIFWFVFLSPLVNCQLYYNFYDTTCPNLTGIVRDNVRSAMAKDARIAASLLRLHFHDCFVIGCDASVLLDDTGTLKGEKNALPNKNSLRGFEVIDTIKAALEKACPSTVSCADILTLAARETVYLSKGPFWYVPLGRRDGTTASESEANNLPSPFEPVENITAKFISKGLEKKDVAVLSGAHTLGFAQCFSFKPRLFDFGGSGKSDPSLDVSLLQNLVKLCPNQADSDTNLAPLDPVTTNTFDNMYYKNIVNNSGLLQSDQALLGDSTIASLVNVYSKWPIMFFRDFAVSMEKMSRIGVLTGSRGQIRTNCRAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 1 EST. Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTTAAATCTAATAATATGCTTCTTTTTGTTTCAATATTTTGGTTTGTGTTCCTTAGTCCTTTAGTGAACTGTCAACTTTATTATAATTTCTATGACACAACATGTCCAAACCTG
ACCGGAATTGTTCGAGACAACGTGCGGTCAGCTATGGCCAAGGACGCAAGGATTGCTGCTTCTCTCCTGCGCCTTCATTTCCATGATTGTTTCGTCATT
GTAAATAATTAAGCTGTCTCA
ATTTTAATTAGTTATTCTTTTAGTTGGGATAATGTTAAAGATTTTTTACATGTGCTGCTTCTTTCATTTTTTGTTACAAAGGGATGTGATGCTTCTGTGCTACTTGATGATACGGGCACT
TTAAAGGGGGAGAAAAATGCACTGCCTAATAAAAATTCACTCAGAGGATTTGAGGTCATTGACACAATCAAGGCTGCATTGGAGAAGGCTTGTCCCTCCACTGTTTCTTGTGCTGATATA
CTTACTCTAGCGGCAAGAGAAACTGTTTATCTA
GTAAGACACCAATTTTTAACTATTTGAAATATAGCATTTAAAATATGATATTAAAAATACATACATGCGGTTGCAACAATTTTTCGA
TTTACTCCTTATCGTTTAAAACATTCTATTTTGGTTCTATAATTTAATTTTTTTTACCTTTCAGTTGTACCTGTCTAATATCATTTGAAACAAACAAGATATAATTCATTTAATCTACCT
TTATCTCAAATGATGTTAGTCAACTTTAGACCCAGGGTCAAAAGGTAAAAATTTGTAATTATAGAAATCACACGAGTAATTAAACAAACAAAAAAAATATATATTTAATAGTTATTTGAT
TTTGATCATAGTTCAATCATATTGAATTTATACTCCAAACATATTAAAACCTTTCATAATATTTCCAGAGTAAAGGTCCATTTTGGTATGTGCCTCTGGGTCGTAGAGATGGTACAACAG
CAAGTGAGAGCGAGGCAAATAACTTGCCATCACCCTTCGAACCAGTAGAAAACATTACCGCCAAGTTTATATCCAAGGGTCTTGAAAAGAAGGATGTGGCAGTACTCTCAG
GTTTGCTAA
TTAATGCTTCTTTCACATTTATATTATATGCTTCTTTCTTGCAGGCTAATCATGAGACTAAAAACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATCATGAGACTAATTAAGCTTAAATTATTCATGTC
TATATAATATGTAATGAATGTAGGTGCACACACTCTTGGCTTTGCTCAATGCTTCTCGTTCAAGCCAAGGCTCTTCGACTTTGGTGGCTCTGGTAAATCTGATCCATCACTTGATGTTTC
ACTTCTACAAAATTTAGTGAAATTGTGTCCAAATCAAGCTGACTCTGACACCAATTTGGCTCCCTTGGATCCCGTCACCACCAACACATTTGACAACATGTATTACAAAAACATTGTGAA
CAATTCGGGGCTGCTTCAATCAGACCAGGCTCTTTTAGGTGACAGCACAATTGCTTCATTAGTCAACGTGTATAGCAAGTGGCCTATTATGTTCTTCAGAGACTTTGCGGTATCTATGGA
GAAAATGAGCCGCATAGGTGTACTCACAGGATCACGGGGGCAAATAAGGACTAACTGTAGGGCTGTTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTTAAATCTAATAATATGCTTCTTTTTGTTTCAATATTTTGGTTTGTGTTCCTTAGTCCTTTAGTGAACTGTCAACTTTATTATAATTTCTATGACACAACATGTCCAAACCTG
ACCGGAATTGTTCGAGACAACGTGCGGTCAGCTATGGCCAAGGACGCAAGGATTGCTGCTTCTCTCCTGCGCCTTCATTTCCATGATTGTTTCGTCATT
GGATGTGATGCTTCTGTGCTA
CTTGATGATACGGGCACTTTAAAGGGGGAGAAAAATGCACTGCCTAATAAAAATTCACTCAGAGGATTTGAGGTCATTGACACAATCAAGGCTGCATTGGAGAAGGCTTGTCCCTCCACT
GTTTCTTGTGCTGATATACTTACTCTAGCGGCAAGAGAAACTGTTTATCTA
AGTAAAGGTCCATTTTGGTATGTGCCTCTGGGTCGTAGAGATGGTACAACAGCAAGTGAGAGCGAGGCA
AATAACTTGCCATCACCCTTCGAACCAGTAGAAAACATTACCGCCAAGTTTATATCCAAGGGTCTTGAAAAGAAGGATGTGGCAGTACTCTCAG
GTGCACACACTCTTGGCTTTGCTCAA
TGCTTCTCGTTCAAGCCAAGGCTCTTCGACTTTGGTGGCTCTGGTAAATCTGATCCATCACTTGATGTTTCACTTCTACAAAATTTAGTGAAATTGTGTCCAAATCAAGCTGACTCTGAC
ACCAATTTGGCTCCCTTGGATCCCGTCACCACCAACACATTTGACAACATGTATTACAAAAACATTGTGAACAATTCGGGGCTGCTTCAATCAGACCAGGCTCTTTTAGGTGACAGCACA
ATTGCTTCATTAGTCAACGTGTATAGCAAGTGGCCTATTATGTTCTTCAGAGACTTTGCGGTATCTATGGAGAAAATGAGCCGCATAGGTGTACTCACAGGATCACGGGGGCAAATAAGG
ACTAACTGTAGGGCTGTTAACTAG

Retrieve as FASTA