Entry information : GmPrx104 (Glyma01g39990.1)
Entry ID 8934
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx104 (Glyma01g39990.1)
Name (synonym) GmPrx104 (Glyma01g39990.1)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx104
start..stop
S start..stop
GmPrx25 655 0 1..328 1..328
MtPrx42 581 0 1..328 1..328
MsPrx16 568 0 4..328 1..325
TrPrx02 533 0 5..328 6..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 51795527..51795742 216 N° 2 51795879..51796079 201 N° 3 51796207..51796372 166 N° 4 51797153..51797556 404
join(51795527..51795742,51795879..51796079,51796207..51796372,51797153..51797556 )


exon

Literature and cross-references GmPrx104 (Glyma01g39990.1)
DNA ref. Phytozome 12:   Gm01 (51795527..51797556)
Protein sequence: GmPrx104 (Glyma01g39990.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (303)
PWM (Da):   %s   36098.27 (33285.8)  
PI (pH):   %s   9.15 (9.48) Peptide Signal:   %s   cut: 26 range:26-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALLNLILVWLFFLSLCLYSCPTSAQLSRHHYAKTCPNVENIVREAVKKKFHQTFVTVPATIRLFFHDCFVQGCDASVLVASTKNNKAEKDHPDNLSLAGDGFDTVIKAKEAVDAVPLCRNKVSCADILAMATRDVIALAGGPFYEVELGRFDGLRSKSSDVNRRLPQAEFNLNQLNSLFAANGLTQTEMIALSGAHTVGFSHCNKFTNRVYNFKSKSRVDPTLNEKYATQLRSMCPRNVDPRIAIDMDPTTPRSFDNVYFKNLQQGKGLFSSDQVLFTDSRSKATVNAFASSSNIFHANFAAAMTKLGRVGVKNAQNGNIRTDCSVI

Retrieve as FASTA  
Remarks Complete sequence from genomic and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTGCTTAACCTCATACTTGTCTGGTTATTTTTCTTGAGTCTGTGTCTTTATTCGTGTCCTACTTCGGCCCAGTTAAGTAGACACCACTATGCAAAAACTTGCCCCAATGTAGAA
AACATTGTCAGAGAAGCAGTCAAAAAGAAGTTTCATCAAACATTTGTTACGGTCCCTGCCACCATTCGTCTCTTCTTCCATGATTGCTTCGTGCAG
GTAATCAATTGCATGCATTTGATT
CATTCACCGCATAAATGTTAAAAAGAAAGTAAAAGAGAAAATCCCCCCATCACAGTGTCTTCTAGTTGAACTAATCAAATTCTATTTATGCTTTGCTTGTAATATTACGCAGGGCTGTGA
TGCCTCGGTTTTGGTTGCATCCACAAAAAACAACAAAGCAGAGAAGGATCACCCTGATAATCTTTCACTAGCTGGAGATGGGTTTGATACAGTGATTAAAGCAAAAGAAGCAGTGGATGC
AGTTCCATTGTGCAGGAACAAAGTTTCATGTGCTGATATTTTAGCTATGGCAACCCGTGATGTTATTGCACTG
GTTTGTTTGTTCATGAATTACTCCTAGCTGACTCTAATTCCGGTGAA
AAACATTTGATTTTTTGAGATGTGACTTATTAGAAGCTTTATTGAATTGTAAATTTATAATGCAATTGCACATTCTTCAGGCTGGTGGGCCTTTCTACGAGGTTGAATTGGGAAGATTTG
ATGGGCTAAGATCTAAATCTTCAGATGTAAATAGGAGGCTGCCTCAGGCAGAGTTCAACTTGAACCAGCTGAATTCACTGTTTGCGGCCAACGGCCTCACCCAAACTGAAATGATAGCTC
TGTCAG
GTAACGCACTTTCCAATACAAGAGTGCCAGCCAAATAACTCAATTCTAAACACATGATCTGTATTCCCAAGGGAATCCCATTATTGGGTTTCTAAGTAATGGGTAAATTTCATC
CACTATCTTTTAACTCTCAATCATGTTTTATTATGCTATTTAAAAATTATAATCAAATCTAAATACGTGAATTAATCTTTTTTTTAACATGATCTTTACTATCAAATGAATTCCGTGCAA
CCAATATGTTGTTAATCAGTTTAACTTCTTTATTATCAAATTTGTATGTTAGAATACTGTGAATTAAAAAACGTAGAAAAAATATTTCACAGTAGTCATCAACAAAATAAATATTTATAT
TGTTTTTATTCTCAATAAATACACAATTATAAATAAATTTTACATTTAGTACTAACAATGGACAGAAAGTAATATTTTGAAAAGGGTTTGGTAGAATAATTTTAAATCCTATTATTAATC
TCTCTACTTTTTTATACGAGAAGTATTGAACTTTTTTACATTTTTAAGATATTGAATTTTTTTATTTAATATTCTTTTATAAAGTAGCAGGAAGTTTTGTCGAAGAATACAGCATTACTT
AGTTTAGTATTCTTGAATTCCTTCATTAAATAAGAATGCAAAATACAGCATAAATATAACTTAGTGTAGGATTATTTTCGTAAAAGGATATTTAAAATTTCGTACTAGAAAAAGAAGAAA
AAAAGAAAAGTCAAGCTAATCATAGTTTGAATTTCTTTATGATAATTGATTCACTCTACACTACAGGTGCTCACACTGTTGGATTCTCCCATTGCAACAAATTCACGAACAGAGTATACA
ATTTCAAGAGCAAAAGTCGAGTGGACCCTACACTGAACGAGAAATACGCAACACAGCTAAGGTCAATGTGCCCAAGGAATGTGGATCCAAGGATTGCAATCGATATGGACCCAACCACTC
CACGGTCATTCGACAATGTTTATTTCAAGAATCTTCAGCAAGGGAAGGGCCTCTTCTCTTCAGACCAAGTTCTCTTCACGGACTCAAGATCCAAGGCCACAGTAAATGCCTTTGCTAGTA
GCAGCAATATCTTTCATGCCAACTTCGCTGCTGCCATGACCAAATTGGGCCGAGTTGGAGTCAAGAATGCACAGAATGGAAACATTCGCACCGATTGTTCTGTCATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTGCTTAACCTCATACTTGTCTGGTTATTTTTCTTGAGTCTGTGTCTTTATTCGTGTCCTACTTCGGCCCAGTTAAGTAGACACCACTATGCAAAAACTTGCCCCAATGTAGAA
AACATTGTCAGAGAAGCAGTCAAAAAGAAGTTTCATCAAACATTTGTTACGGTCCCTGCCACCATTCGTCTCTTCTTCCATGATTGCTTCGTGCAG
GGCTGTGATGCCTCGGTTTTGGTT
GCATCCACAAAAAACAACAAAGCAGAGAAGGATCACCCTGATAATCTTTCACTAGCTGGAGATGGGTTTGATACAGTGATTAAAGCAAAAGAAGCAGTGGATGCAGTTCCATTGTGCAGG
AACAAAGTTTCATGTGCTGATATTTTAGCTATGGCAACCCGTGATGTTATTGCACTG
GCTGGTGGGCCTTTCTACGAGGTTGAATTGGGAAGATTTGATGGGCTAAGATCTAAATCTTCA
GATGTAAATAGGAGGCTGCCTCAGGCAGAGTTCAACTTGAACCAGCTGAATTCACTGTTTGCGGCCAACGGCCTCACCCAAACTGAAATGATAGCTCTGTCAG
GTGCTCACACTGTTGGA
TTCTCCCATTGCAACAAATTCACGAACAGAGTATACAATTTCAAGAGCAAAAGTCGAGTGGACCCTACACTGAACGAGAAATACGCAACACAGCTAAGGTCAATGTGCCCAAGGAATGTG
GATCCAAGGATTGCAATCGATATGGACCCAACCACTCCACGGTCATTCGACAATGTTTATTTCAAGAATCTTCAGCAAGGGAAGGGCCTCTTCTCTTCAGACCAAGTTCTCTTCACGGAC
TCAAGATCCAAGGCCACAGTAAATGCCTTTGCTAGTAGCAGCAATATCTTTCATGCCAACTTCGCTGCTGCCATGACCAAATTGGGCCGAGTTGGAGTCAAGAATGCACAGAATGGAAAC
ATTCGCACCGATTGTTCTGTCATTTAA

Retrieve as FASTA