Entry information : GmPrx106 (Glyma02g01190.1)
Entry ID 8936
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-18 (Christophe Dunand)
Peroxidase information: GmPrx106 (Glyma02g01190.1)
Name (synonym) GmPrx106 (Glyma02g01190.1)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx106
start..stop
S start..stop
GmPrx332 604 0 3..319 5..324
GmPrx192 604 0 3..319 5..324
VvPrx27 474 5e-170 3..319 9..332
VvPrx28 471 7e-169 5..319 12..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 886629..886832 204 N° 2 886926..887681 756  
join(886629..886832,886926..887681)


exon

Literature and cross-references GmPrx106 (Glyma02g01190.1)
DNA ref. Phytozome 12:   Gm02 (886629..887681)
Protein sequence: GmPrx106 (Glyma02g01190.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (298)
PWM (Da):   %s   34698.38 (32312.2)  
PI (pH):   %s   8.57 (8.75) Peptide Signal:   %s   cut: 22 range:22-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVLHMHVMLCCFVLIVSSASASLKVDFYKTTCPSAEAIVRRAVNKAVSLNPGIAAGLIRMHFHDCFVRGCDGSVLLESTAGNPSEREHPANNPSLRGFEVIDEAKAQIEAECPHTVSCSDILAFAARDSTNRVGGINYVVPAGRRDGRVSIRDEASQLPRPTFNTQQLISNFEQKGLSADEMVTLSGAHSIGVSHCSSFSDRLYSFNATFPQDPSMDPKFATSLKTKCLPRSDNTVVLDASTPNRLDNNYYALLKNQRGLLTSDQTLLTSPSTRPMVLTNAKHGSKWARKFAKAMVHMGSIQVLTGSQGEIRTRCSVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1). Incorrect prediction from phytozome (S hort 5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTCTACACATGCATGTAATGCTCTGTTGCTTTGTTCTAATTGTCTCATCTGCCTCCGCATCTTTGAAGGTGGATTTCTACAAAACTACGTGTCCATCTGCGGAGGCAATAGTGAGA
AGAGCTGTAAACAAAGCTGTTTCTCTCAACCCGGGCATCGCTGCTGGTTTGATCAGAATGCACTTTCATGATTGTTTTGTCAGG
GTAATTAACTACTTCATCTTAATATAGTCATGTATA
GTGCAAATCCATTTCTGAAGTTGATGCTTAATTAATTATATTGCTATATATATGCAGGGTTGTGATGGTTCTGTACTATTAGAATCCACAGCGGGTAACCCATCAGAGAGAGAGCACCCT
GCCAACAACCCAAGCTTGCGTGGCTTCGAAGTGATCGATGAGGCCAAGGCCCAAATAGAGGCAGAGTGTCCTCACACTGTGTCCTGTTCTGACATTCTTGCTTTTGCTGCTAGAGACAGC
ACCAACAGAGTCGGAGGCATAAACTATGTAGTACCAGCTGGACGCAGAGATGGTCGTGTCTCTATCAGAGACGAAGCGTCACAACTGCCTCGTCCAACATTCAACACACAACAACTCATT
AGTAACTTTGAACAAAAAGGGTTGTCTGCAGATGAAATGGTGACACTGTCTGGAGCACATTCTATTGGTGTCTCGCACTGTTCCTCCTTCTCCGACCGCTTGTACTCTTTCAATGCCACG
TTTCCTCAAGACCCTTCTATGGATCCCAAGTTTGCTACGTCGTTGAAAACCAAGTGTCTGCCTCGGAGTGATAACACAGTGGTGCTTGATGCTTCCACGCCTAACCGTTTGGACAACAAC
TACTACGCACTGCTAAAGAACCAGCGTGGTTTGTTGACCTCAGATCAGACGTTGTTGACCAGCCCCTCAACGAGACCAATGGTTCTAACCAATGCTAAACATGGTTCAAAATGGGCACGT
AAGTTTGCTAAGGCAATGGTGCATATGGGTTCCATCCAAGTGCTAACTGGCTCACAAGGCGAGATCAGGACCCGCTGTAGCGTCGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTCTACACATGCATGTAATGCTCTGTTGCTTTGTTCTAATTGTCTCATCTGCCTCCGCATCTTTGAAGGTGGATTTCTACAAAACTACGTGTCCATCTGCGGAGGCAATAGTGAGA
AGAGCTGTAAACAAAGCTGTTTCTCTCAACCCGGGCATCGCTGCTGGTTTGATCAGAATGCACTTTCATGATTGTTTTGTCAGG
GGTTGTGATGGTTCTGTACTATTAGAATCCACAGCG
GGTAACCCATCAGAGAGAGAGCACCCTGCCAACAACCCAAGCTTGCGTGGCTTCGAAGTGATCGATGAGGCCAAGGCCCAAATAGAGGCAGAGTGTCCTCACACTGTGTCCTGTTCTGAC
ATTCTTGCTTTTGCTGCTAGAGACAGCACCAACAGAGTCGGAGGCATAAACTATGTAGTACCAGCTGGACGCAGAGATGGTCGTGTCTCTATCAGAGACGAAGCGTCACAACTGCCTCGT
CCAACATTCAACACACAACAACTCATTAGTAACTTTGAACAAAAAGGGTTGTCTGCAGATGAAATGGTGACACTGTCTGGAGCACATTCTATTGGTGTCTCGCACTGTTCCTCCTTCTCC
GACCGCTTGTACTCTTTCAATGCCACGTTTCCTCAAGACCCTTCTATGGATCCCAAGTTTGCTACGTCGTTGAAAACCAAGTGTCTGCCTCGGAGTGATAACACAGTGGTGCTTGATGCT
TCCACGCCTAACCGTTTGGACAACAACTACTACGCACTGCTAAAGAACCAGCGTGGTTTGTTGACCTCAGATCAGACGTTGTTGACCAGCCCCTCAACGAGACCAATGGTTCTAACCAAT
GCTAAACATGGTTCAAAATGGGCACGTAAGTTTGCTAAGGCAATGGTGCATATGGGTTCCATCCAAGTGCTAACTGGCTCACAAGGCGAGATCAGGACCCGCTGTAGCGTCGTTAATTAA

Retrieve as FASTA