Entry information : GmPrx111 (Glyma02g14090.1)
Entry ID 8939
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-23 (Christophe Dunand)
Peroxidase information: GmPrx111 (Glyma02g14090.1)
Name (synonym) GmPrx111 (Glyma02g14090.1)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx111
start..stop
S start..stop
GmPrx94 647 0 1..337 1..337
MtPrx40 595 0 1..337 1..338
MePrx12 532 0 1..337 3..340
PpePrx72 528 0 1..337 1..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12470069..12470299 231 N° 2 12471136..12471327 192 N° 3 12471449..12471614 166 N° 4 12472254..12472678 425
join(12470069..12470299,12471136..12471327,12471449..12471614,12472254..12472678 )


exon

Literature and cross-references GmPrx111 (Glyma02g14090.1)
DNA ref. Phytozome 12:   Gm02 (12470069..12472678)
Protein sequence: GmPrx111 (Glyma02g14090.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (310)
PWM (Da):   %s   37001.41 (33859.8)  
PI (pH):   %s   4.71 (4.55) Peptide Signal:   %s   cut: 28 range:28-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPSFPSKSFLHVVLIFCFLGATRLYANDPYLTLDYYASTCPAVFDIVRKEMECAVLSDPRNAAMIIRLHFHDCFVQGCDGSILLDDTITLKGEKNAATNIHSLKGLGIVDKIKNIVESECPGIVSCADILTIAARDAVILVGGPYWDVPVGRKDSVTANFDLANTNLPTPDESLLSIIAKFLYQGLSVTDMVALVGAHTIGMAQCKNFRSRIYGDLESTSVKNPISESHLSNLRSVCPPIGGGDNNITAMDYMTPNLFDNSFYQLLLNGEGLLNSDQEIYSSVFGIETREIVKNYAADPLAFFQQFSESMVKMGNITNSESFFTGEVRKNCRFVNT*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTCCTTTCCTTCAAAATCCTTTCTGCATGTTGTTCTTATCTTTTGCTTTCTTGGTGCCACCAGATTGTATGCGAATGACCCTTATCTAACACTGGATTACTATGCATCAACT
TGCCCCGCTGTGTTTGACATTGTTAGGAAGGAAATGGAATGTGCAGTGCTTTCTGATCCCCGCAATGCAGCCATGATAATTCGGCTACACTTCCATGATTGCTTTGTTCAG
GTATGTAAC
TTTATTATCTAATATTGGCAGTGTTTTCAAGTTAAGAAACAAAGTACATCACATAGTTTTTTTTTTGTTTAAATACATTTTTCGTCTCTGTAATTTAGGTTTTTTTCATTTTTGTCCTGA
CAAAAAAAAATTGTTTCAGCAAAATGTGTTTTTTTGTTTTTCATCCTTAAAGAGCTTTTGATACTACTTTGAACACTAAAAATATTTTAATCAAAGAAAAATGTGTTATCTAAAGTGTTT
TAAAGATGAAAAATAAAACAAACACATTTTGTAATGACTAAAACGAAAAAAAAAAAAATTACAAGAACGAAAAATATATTTAAACCTTTTTTTTGGCAAATTACATTACATAATACTAGT
CATAGTTACCTAATGCTCTCAATAACTTGTTGGTTACCAAATTCTTTTGATCACGTATTGAATTTTATTTGAAGTCTTTATTAATGCATAGAGTAAATTACATTGACACTTCCTGAATTT
TTTTTTGAATTGCACATGATATTTCTCATTTTTCTATTTCTCCACTATTTCTCTTAATTGTTTGAAAGATATTACATCATGCACTCCTACAAGAAAGATTGTTGTAAATGAAGGGGTGAT
TATGAAAAAAGAATGAGGTGTATCAACGTAATTTACTCTAATGTATAAAGTGAATGTACCAACACTAATCATATGTTGTACCCGTACCTCGTACATGGTAATTATGGTACTAGTAGTAGT
TCTATAGTTTCATTTTGAGAAAGCCAATTTCATATAATATAAAGTCAATATGAAACTAATGGGAAAAAGTAAATACGCAGTAACTAAATGTGAAATTCATTGCTCAGGGATGCGACGGAT
CAATTTTGCTTGATGATACAATCACACTTAAAGGTGAGAAAAACGCAGCTACCAACATCCACTCTTTAAAAGGCTTGGGAATTGTTGATAAAATCAAGAACATAGTTGAATCAGAGTGCC
CTGGAATTGTTTCTTGCGCTGATATTCTCACTATTGCAGCCAGAGATGCTGTGATTCTG
GTAAAAGACACTTCTTGCTTCTAGATTTTTTTCACATTGTTTATACCATATTTTATCTTTA
ATTTTCTGCATATAAGTTACTAGAATTATGCACATGCCTGTGTCCTCTGATGTTTTGTAGGTGGGTGGACCTTACTGGGATGTTCCTGTGGGAAGGAAGGATTCTGTCACTGCAAATTTT
GATCTTGCCAACACCAATCTTCCCACTCCTGATGAGAGCCTTCTCTCTATCATTGCCAAGTTTCTTTACCAAGGACTATCTGTCACAGATATGGTAGCCCTTGTAG
GTGTGTTAGTGTTC
CTAATAATGCAATAAAACTTTGTGTTTAAATATGTTTTTAATCATGCAAATATGATAAATTTTTATTTCACTCCTTCAAAAAAACATATTGTTGGGTTTTAGTCTTCATAAATATAATTT
TTTTAAAGTAATTTCTTAGTATTTAGTAATGACGTGACATATATTTAAACATGTCATATGAATAATAAGTCTGACATAATATGTAATTTGATATGCTTGAATATATGTTACCTCATTAGT
AAATGATGAAAAAAATTATTATTAAAACTTTTTTTTCCACTAAGTTTGGAAAAGATTGTCTTGTGTTATAACCACGATAAAAGTTAAGTCTATTAAGTCCAGTTTGGTGCCCCATGCATT
GCACCTTGAGCAGACGTTTGCGAAAAGAAGCCTTTGGTATCTTTGATTCAACTCGTTGAGGGAGGTGCCAACGGATTTCCAAAAGTAGCTTAAATTTGACTCTCACTTTTACCACAATAA
ACCATATTTTAGCTAATAGAAAAATGAACAAAATCTTACAACAAAGCTGCATAGAATCAATAATCATAATATGATCACTGTTATTGAAATTGATCTGCATTTAGCCATTTCTTCGTACCA
CATTTTCTGATCACTAAGCCTGCAGGAGCCCACACCATTGGCATGGCACAGTGTAAGAATTTCCGTTCAAGAATTTATGGAGACTTGGAATCAACCTCAGTGAAAAATCCAATCTCCGAG
AGTCACCTAAGCAACTTGAGATCTGTTTGTCCACCTATTGGGGGAGGAGACAATAACATAACAGCAATGGACTACATGACACCAAATCTCTTTGACAATTCTTTCTACCAATTACTACTA
AATGGGGAGGGACTTCTCAACTCAGACCAAGAAATATACTCAAGTGTGTTTGGAATTGAAACTAGAGAGATTGTGAAGAACTATGCAGCAGATCCTCTGGCTTTCTTCCAACAATTCTCA
GAGTCAATGGTGAAAATGGGAAACATCACAAACTCAGAAAGCTTCTTCACTGGGGAAGTTAGGAAGAACTGCAGATTTGTGAACACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTCCTTTCCTTCAAAATCCTTTCTGCATGTTGTTCTTATCTTTTGCTTTCTTGGTGCCACCAGATTGTATGCGAATGACCCTTATCTAACACTGGATTACTATGCATCAACT
TGCCCCGCTGTGTTTGACATTGTTAGGAAGGAAATGGAATGTGCAGTGCTTTCTGATCCCCGCAATGCAGCCATGATAATTCGGCTACACTTCCATGATTGCTTTGTTCAG
GGATGCGAC
GGATCAATTTTGCTTGATGATACAATCACACTTAAAGGTGAGAAAAACGCAGCTACCAACATCCACTCTTTAAAAGGCTTGGGAATTGTTGATAAAATCAAGAACATAGTTGAATCAGAG
TGCCCTGGAATTGTTTCTTGCGCTGATATTCTCACTATTGCAGCCAGAGATGCTGTGATTCTG
GTGGGTGGACCTTACTGGGATGTTCCTGTGGGAAGGAAGGATTCTGTCACTGCAAAT
TTTGATCTTGCCAACACCAATCTTCCCACTCCTGATGAGAGCCTTCTCTCTATCATTGCCAAGTTTCTTTACCAAGGACTATCTGTCACAGATATGGTAGCCCTTGTAG
GAGCCCACACC
ATTGGCATGGCACAGTGTAAGAATTTCCGTTCAAGAATTTATGGAGACTTGGAATCAACCTCAGTGAAAAATCCAATCTCCGAGAGTCACCTAAGCAACTTGAGATCTGTTTGTCCACCT
ATTGGGGGAGGAGACAATAACATAACAGCAATGGACTACATGACACCAAATCTCTTTGACAATTCTTTCTACCAATTACTACTAAATGGGGAGGGACTTCTCAACTCAGACCAAGAAATA
TACTCAAGTGTGTTTGGAATTGAAACTAGAGAGATTGTGAAGAACTATGCAGCAGATCCTCTGGCTTTCTTCCAACAATTCTCAGAGTCAATGGTGAAAATGGGAAACATCACAAACTCA
GAAAGCTTCTTCACTGGGGAAGTTAGGAAGAACTGCAGATTTGTGAACACATAA

Retrieve as FASTA