Entry information : GmPrx120 (Glyma02g40020.1)
Entry ID 8941
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-23 (Christophe Dunand)
Peroxidase information: GmPrx120 (Glyma02g40020.1)
Name (synonym) GmPrx120 (Glyma02g40020.1)
Class Class III peroxidase    [Orthogroup: Prx040]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx120
start..stop
S start..stop
GmPrx62 612 0 1..323 33..359
PvPrx10 549 0 1..323 8..327
GmPrx70 519 0 15..323 18..325
MtPrx01 516 0 6..322 11..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45221980..45222186 207 N° 2 45220493..45220687 195 N° 3 45218992..45219561 570  
complement(join(45218992..45219561,45220493..45220687,45221980..45222186))


exon

Literature and cross-references GmPrx120 (Glyma02g40020.1)
DNA ref. Phytozome 12:   Gm02 (45222186..45218992)
Protein sequence: GmPrx120 (Glyma02g40020.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (301)
PWM (Da):   %s   35546.39 (33080.1)  
PI (pH):   %s   10.17 (10.17) Peptide Signal:   %s   cut: 23 range:23-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFHILVLVVAMVTLMIPTNANLSPHFYDKVCPQALPVIKSVVQRAIIRERRIGASLLRLHFHDCFVNGCDGSILLDDTRNFTGEKTALPNLNSVRGFSVVDEIKEAVDKACKRPVVSCADILAIAARDSVAIYGGPHYWYQVLLGRRDARTASKAAANSNLPPPSFSFSQLVSNFKSHGLNVRDLVALSGGHTLGFARCSTFRNRIYNASNNNIIDPKFAASSRKTCPRSGGDNNLHPFDATPARVDTAYYTNLLHKKGLLHSDQELFKGKGTESDKLVQLYSRSPLVFATDFKASMIKMGNMKPLTGKKGEIRCNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTTTCATATCCTTGTGCTCGTGGTTGCTATGGTCACATTGATGATCCCTACGAATGCAAACCTCTCTCCCCATTTCTATGATAAAGTATGCCCTCAGGCATTGCCAGTCATA
AAGTCAGTGGTTCAACGAGCAATTATCCGTGAGCGACGCATCGGAGCATCTCTTCTGCGCTTGCATTTCCATGATTGTTTCGTAAAT
GTAAGTTACTATTAAACATTAATCTCAATATAT
TAATGTGCTATGAAACAAGAAAAATATCTTTACTTATCACAATTTAATATGTACTAGTTTTATGAAGGGAGCATGCATGTGCTTTTAGTGTTTATATTTTCGATTAAACATGATCAAGAG
CTTCAAACTTTTAATGGATGAACTCAGTCCTCAAATTTTCGTAAGTCCTTCTTTTTATTTTCTTTTTGGCAGTATAAGTCCTCTTAATTACTTATATATGTTGCTTATCTTATCCCTTAA
TTCCTATCCATTTTAGAATTTCATATTCACACTTACACTCAACTAATACAATTTTTAATTTTGTATAATATCACCATTTAGTCACAATTAGGAATTATTGCAGTCTTAATTTTGTGATAT
ATTTGATTATCTTCAAAAAAATATTAGCACATTAAAGTCTTACCAAAAAATTCAGTTTTGTAGAAACAAAACTTTGGTGACTTTTGTAAATTTAAGTTTAACCCAAACTTATGTTTTCAT
ATTTTAATTTAAACATATTCAAAGTTATTTTGCATTTTTATTTTCTGTTGTAATTTGTTGAAAATTCTAATTTTTACACTTATTTTTCTTATCATATCACTTTATCTTTATAGTTTATCT
TTCTTCCCTTTTAAAATGTATAGGTACATCACATGATCACAAGAGTCTGAAAATTATTCTTTTCTAGAATTTTCTTAAGGTGATTACATGCATACGTTGATAGGAACTTCATAACAAGTT
GCATGTACCAATCCATTTTTATATTTTACTTTTTTTTTTTTTGCAATTATTGCTCCTATAACCACTTTTTATCCTATCTTATCATCCACGTAAAGTAACAGTGGGCCAGCTAGCAATAAT
TAATTGAACTCTATTATAAGTGACAGAAATCATGTTATGATATGAAATAATGAAACTATATACTAATTTTAAATTGTTTGGAAAACAATGCACACCTAACTAATGGCTGCTTTCTTCCAT
TAATTTTTCAAATAAAAACAGCAGCTTATTGTAATTACAGTTCCGAGTCAAATTTCAATCTTTGATGTTCAATGTTTTATCTTGTTTTGTGAGCTGTAAAATGCTTATAGCAGGGTAAAA
TAGATAGTCTAATTAAGATGGACCCCTCCACATATATTAATAAAAAAAATAGTCCAAAGAAAACCAAGATAATGTTAATTAATTCACCGTGTCACTTCGATCTAGTTCTACTATAGTAAT
AGTACCATAATTTAATTTAATTTACTGAAATATAATATGAATGTATTTGAAACTACAAGGGGTGTGATGGATCAATATTGCTAGATGACACCCGAAACTTCACTGGCGAGAAGACAGCAT
TGCCGAATCTTAATTCAGTCAGAGGTTTTTCGGTGGTTGATGAAATCAAAGAAGCGGTGGACAAAGCCTGCAAACGCCCTGTGGTCTCATGTGCAGATATCTTGGCCATTGCAGCTCGTG
ATTCTGTAGCCATA
GTAAGTAGTAGTGTAGTACTTACTAACAAACCTTTCATTCTCATATATAGCTACACTATAAGAAAATGTCATTACTCATTATTAACAAAAAGATTAATTAATAATT
AAGCTTGCTCTCATGGGTATAGTTAATATTTTATCTGACAGAAACTAAACTACTAGTTCTGCCATGGCGAGCCCTCAGCAAAAAGTATAATGCATCATACTAACATATATGGAATATTAA
TGAACACCAAACTTTGGATAATAAGTACAAGTACAAATATTGTATTATAGATAATATGATGGAATAGGAAAATATTTACCAAACAAAAAAGAAAGAAAATAAAGTGCTAATTAATGAGGT
GCTTAAAGTAATTAATTGCATGTTTGGAAAATAAAATGTTTGTCAACACATCAAGATTCTTGCTTTTGCGTTTATTTAGTGTTGGACTGTTAAATTTATCTTAAAATATGCATCACAATA
AAAGCAAAAATAAAATAAACATAGCCTAAGTATATCATACCCACATACCACCATTTTATTAAGCAATAATTATTAGTCTATCGTATCAAATCTCTGCTTGATAAATCGTAGAGTTTGTGA
TTTTAAATTTTGATTTCGAGTCCGTCTAAATTGAATTTAATTTACAAAAATTCGCAAAAGATCAAATAAGTCATACTTAAGTCTTCTCATTTTAGAAATTCAAATTGNNNNNNNNNNNNN
NNNNNNNNNNTACATTAACTTAAAAAATGTATCGTGTCAGATATCTTGTTTTGTCACCTTTATTGATAGTATAAATCTATACTTAAACCTTAAATTTTCACTGAAGAAAATCAATTTCAA
CTTAAGCAAGTTTAAACTAACAATTTTTTTGTTAATTGTGCTAGTAGTAATATTAGAAGTTTTAGAAAACGTAATAATATAACATGCTTCTTTCACTGTTAATAGTATGGGGGTCCACAC
TATTGGTACCAAGTATTGTTGGGCAGAAGAGATGCAAGAACTGCAAGCAAAGCTGCTGCAAATTCCAATCTTCCTCCTCCATCTTTCAGCTTCTCACAACTTGTTTCCAACTTCAAATCC
CACGGCTTAAACGTGAGGGACCTTGTGGCCCTCTCTGGAGGCCACACCCTAGGGTTTGCAAGGTGCAGCACCTTCAGAAACAGAATCTACAACGCAAGCAACAACAACATAATAGACCCA
AAATTTGCAGCATCTTCGAGGAAGACATGTCCGCGAAGCGGAGGAGACAACAACTTGCATCCATTTGATGCTACTCCTGCGAGAGTTGACACTGCATATTACACGAATTTGCTGCACAAA
AAGGGTCTTCTCCATTCTGATCAAGAGCTGTTCAAGGGAAAAGGCACAGAAAGTGACAAATTGGTGCAACTATATAGTAGAAGCCCTTTGGTTTTTGCTACAGATTTTAAAGCTTCCATG
ATCAAGATGGGGAACATGAAGCCTCTCACTGGGAAGAAGGGAGAGATCAGATGCAATTGCAGAAGGGTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTTTCATATCCTTGTGCTCGTGGTTGCTATGGTCACATTGATGATCCCTACGAATGCAAACCTCTCTCCCCATTTCTATGATAAAGTATGCCCTCAGGCATTGCCAGTCATA
AAGTCAGTGGTTCAACGAGCAATTATCCGTGAGCGACGCATCGGAGCATCTCTTCTGCGCTTGCATTTCCATGATTGTTTCGTAAAT
GGGTGTGATGGATCAATATTGCTAGATGACACC
CGAAACTTCACTGGCGAGAAGACAGCATTGCCGAATCTTAATTCAGTCAGAGGTTTTTCGGTGGTTGATGAAATCAAAGAAGCGGTGGACAAAGCCTGCAAACGCCCTGTGGTCTCATGT
GCAGATATCTTGGCCATTGCAGCTCGTGATTCTGTAGCCATA
TATGGGGGTCCACACTATTGGTACCAAGTATTGTTGGGCAGAAGAGATGCAAGAACTGCAAGCAAAGCTGCTGCAAAT
TCCAATCTTCCTCCTCCATCTTTCAGCTTCTCACAACTTGTTTCCAACTTCAAATCCCACGGCTTAAACGTGAGGGACCTTGTGGCCCTCTCTGGAGGCCACACCCTAGGGTTTGCAAGG
TGCAGCACCTTCAGAAACAGAATCTACAACGCAAGCAACAACAACATAATAGACCCAAAATTTGCAGCATCTTCGAGGAAGACATGTCCGCGAAGCGGAGGAGACAACAACTTGCATCCA
TTTGATGCTACTCCTGCGAGAGTTGACACTGCATATTACACGAATTTGCTGCACAAAAAGGGTCTTCTCCATTCTGATCAAGAGCTGTTCAAGGGAAAAGGCACAGAAAGTGACAAATTG
GTGCAACTATATAGTAGAAGCCCTTTGGTTTTTGCTACAGATTTTAAAGCTTCCATGATCAAGATGGGGAACATGAAGCCTCTCACTGGGAAGAAGGGAGAGATCAGATGCAATTGCAGA
AGGGTCAATTAA

Retrieve as FASTA