Entry information : GmPrx127 (Glyma03g04670.1)
Entry ID 8947
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-23 (Christophe Dunand)
Peroxidase information: GmPrx127 (Glyma03g04670.1)
Name (synonym) GmPrx127 (Glyma03g04670.1)
Class Class III peroxidase     [Orthogroup: Prx012]*
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx127
start..stop
S start..stop
GmPrx126 485 1e-174 1..325 1..321
GmPrx132 481 5e-173 1..325 1..319
GmPrx130 472 2e-169 1..325 1..319
GmPrx129 471 7e-169 1..325 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4853595..4853822 228 N° 2 4853099..4853293 195 N° 3 4851872..4852426 555  
complement(join(4851872..4852426,4853099..4853293,4853595..4853822))


exon

Literature and cross-references GmPrx127 (Glyma03g04670.1)
DNA ref. Phytozome 12:   Gm03 (4853822..4851872)
Protein sequence: GmPrx127 (Glyma03g04670.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (305)
PWM (Da):   %s   35696.7 (33452.5) Transmb domain:   %s   i5-27o
PI (pH):   %s   4.59 (4.45) Peptide Signal:   %s   cut: 21 range:21-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRVYLSVLLHAFVSTALATFIHATIFSPLSPNYYEFSCPNALTAIQIIVEAAVQKEPRMGASLLRLHFHDCFVNGCDGSILLDSSPTIDSEKDALPNINSVRGFEVVDDIKKAVDEACGQPIVSCADILAVAARDSVVTLGGPTWEVQLGRRDSTTASKEAANANLPAPSFDLSELINNFNNHSLDVKDLVVLSGAHTIGFSFCKFFKDRVYNDTNINPIYAQQLRNICPIDGSGDFNLGPLDQTSPLLFNLQYFSDLFQYKGLLHSDQELFNGGCTDAMVERYSYDYIAFFQDFANSMIKMGNIQPLTGTQGEIRVNCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGCGTGTGTATTTGTCTGTTCTTCTCCATGCCTTTGTGTCTACAGCTCTTGCAACGTTTATTCATGCCACAATTTTCTCACCACTGTCACCTAATTACTATGAATTTTCGTGC
CCTAATGCTTTGACTGCCATCCAAATTATAGTAGAAGCTGCGGTGCAGAAAGAGCCTCGTATGGGGGCTTCTTTACTACGCTTGCACTTCCATGATTGCTTTGTTAAC
GTAAGACACATT
CTATTTATTTGTTAATATACAATCACTTGTTTTTTTAGAAAGAAAAAGAAATAACAAGTTACATTTTTGTGTACTTTAAGAAAATTTAAGTTATGATTTGTTAAAACATTCTTTAAAAAA
ATATGGGTGTACACTAGTATATGTTAACAAACACACGTAGACATATAATATTTTTTTTCTAAGATATGCATATTACCTTAAACACCATATGGGAGTAATTCTTAGATGATGTAAATATGT
GAGTCTAACTAACAATTACTAATTGGTTTTGTAATTGGTGTCTCATCAGGGTTGTGATGGTTCAATTCTACTAGACTCTTCACCCACCATTGACAGCGAAAAAGATGCACTTCCTAATAT
TAATTCTGTTAGAGGATTTGAAGTGGTGGATGATATAAAGAAGGCTGTGGACGAAGCATGTGGACAACCAATTGTTTCTTGCGCTGACATATTGGCGGTTGCAGCTCGTGACTCCGTGGT
TACA
GTGAGTAATAATTAATAACACTATAACATTACTAGGTACTAAGTACTTAATTTATAACCCCAAATGTTTTATGAGTTTAATTTTTAATGTTTATCAATATATATACTCCAATATTT
TTTTTCTATGGTTAACGTTATGATTTGAATCAGTCGGTGGTGAATTTTATTTTATAATCGGAATCGAGTAGTATTAATTATTACGATATCAAATATTACTATACGGGGAAGATGAAATGC
ATTTGTCTTCGTAAAACTATGACTAGACAAAAGTCAAATAAATGTAGTATAGTAGTGCTACGAAACGTAATACTATAATGTTATTATCTAGTGACTCAGCGACTCAAGTTGGAATATTAT
TTAGATGATATATATTTACAACAGGAGTAATCTCAACCACCTATAAATATATATGGTCACAAAAGTTTTATTCGTGAACTATATTTAGGTCAGAAAAGCTGGTGGGGTTATTATGAGTGC
TATTTGGGGTTAATTAAGAAATTAAAAATTACTTTTTTTTCCTATTACAACCATGCAATATTTATCATTAACGTGCTTCGTCTCAATGCTTAATGCCTTAATGAATCATTAATTATTAGT
ATATATATTGTTTTAATTGATCTTTTTATTTATTAATTGTGAATATGAATTTACATGTTCATTCTGCATTATGCAGTTAGGTGGGCCAACATGGGAAGTTCAATTGGGGAGAAGAGATTC
CACCACAGCAAGCAAAGAAGCAGCAAATGCAAACCTTCCAGCACCAAGTTTCGACCTCTCTGAACTCATCAACAACTTCAACAACCATAGTCTTGATGTGAAGGACCTAGTTGTTCTTTC
AGGGGCCCACACCATTGGATTTTCATTTTGTAAATTTTTTAAGGACCGTGTCTACAATGACACCAACATTAACCCCATCTATGCACAACAACTTAGAAACATTTGCCCTATAGATGGTAG
TGGTGACTTCAACCTTGGTCCTTTGGACCAAACCTCACCACTTTTATTTAACCTACAATATTTCTCTGATTTGTTCCAATACAAAGGACTTCTTCACTCTGATCAAGAACTCTTCAACGG
GGGTTGTACTGATGCAATGGTTGAACGTTACAGCTATGATTACATAGCTTTCTTCCAGGACTTTGCCAATTCGATGATTAAGATGGGAAATATTCAGCCCCTCACTGGGACTCAAGGAGA
AATTCGTGTTAACTGCAGGGTAGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGCGTGTGTATTTGTCTGTTCTTCTCCATGCCTTTGTGTCTACAGCTCTTGCAACGTTTATTCATGCCACAATTTTCTCACCACTGTCACCTAATTACTATGAATTTTCGTGC
CCTAATGCTTTGACTGCCATCCAAATTATAGTAGAAGCTGCGGTGCAGAAAGAGCCTCGTATGGGGGCTTCTTTACTACGCTTGCACTTCCATGATTGCTTTGTTAAC
GGTTGTGATGGT
TCAATTCTACTAGACTCTTCACCCACCATTGACAGCGAAAAAGATGCACTTCCTAATATTAATTCTGTTAGAGGATTTGAAGTGGTGGATGATATAAAGAAGGCTGTGGACGAAGCATGT
GGACAACCAATTGTTTCTTGCGCTGACATATTGGCGGTTGCAGCTCGTGACTCCGTGGTTACA
TTAGGTGGGCCAACATGGGAAGTTCAATTGGGGAGAAGAGATTCCACCACAGCAAGC
AAAGAAGCAGCAAATGCAAACCTTCCAGCACCAAGTTTCGACCTCTCTGAACTCATCAACAACTTCAACAACCATAGTCTTGATGTGAAGGACCTAGTTGTTCTTTCAGGGGCCCACACC
ATTGGATTTTCATTTTGTAAATTTTTTAAGGACCGTGTCTACAATGACACCAACATTAACCCCATCTATGCACAACAACTTAGAAACATTTGCCCTATAGATGGTAGTGGTGACTTCAAC
CTTGGTCCTTTGGACCAAACCTCACCACTTTTATTTAACCTACAATATTTCTCTGATTTGTTCCAATACAAAGGACTTCTTCACTCTGATCAAGAACTCTTCAACGGGGGTTGTACTGAT
GCAATGGTTGAACGTTACAGCTATGATTACATAGCTTTCTTCCAGGACTTTGCCAATTCGATGATTAAGATGGGAAATATTCAGCCCCTCACTGGGACTCAAGGAGAAATTCGTGTTAAC
TGCAGGGTAGTGAACTAG

Retrieve as FASTA