Entry information : GmPrx129 (Glyma03g04710.1)
Entry ID 8949
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx129 (Glyma03g04710.1)
Name (synonym) GmPrx129 (Glyma03g04710.1)
Class Class III peroxidase    [Orthogroup: Prx040]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx129
start..stop
S start..stop
GmPrx128 651 0 1..319 1..319
GmPrx130 650 0 1..319 1..319
GmPrx131 646 0 1..319 1..319
GmPrx97 614 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4908195..4908410 216 N° 2 4907589..4907783 195 N° 3 4906183..4906731 549  
complement(join(4906183..4906731,4907589..4907783,4908195..4908410))


exon

Literature and cross-references GmPrx129 (Glyma03g04710.1)
DNA ref. Phytozome 12:   Gm03 (4908410..4906183)
Protein sequence: GmPrx129 (Glyma03g04710.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (294)
PWM (Da):   %s   34721.08 (31933.7) Transmb domain:   %s   i5-27o
PI (pH):   %s   5.18 (4.92) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRGYFFVVLHALVFASIATSAFSQLSPNYYDYSCPKALSTIKSVVEASVQKERRMGASLLRLHFHDCFVNGCDGSILLDSTSSIDSEKNAAANLQSARGFEVVDDIKKAVDEACGKPVVSCADILAVAARDSVVALGGPSWKVRLGRRDSTTASREAADASIPAPFFSLSELITNFKNHGLDEKDLVVLSGGHSIGFARCVTFKDHIYNDSNIDPHFAQQLKYICPTNGGDSNLSPLDSTAAKFDINYYSNLVQKKGLLHSDQELFNGGSTDELVKEYSDDTEDFYEDFANSMIKMGNIQSLTGNQGEIRVNCRNVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCACGTGGGTATTTCTTTGTTGTTCTCCATGCCTTAGTGTTTGCATCTATTGCAACCTCAGCTTTCTCACAATTGTCACCTAATTACTATGATTATTCGTGCCCTAAAGCTTTG
AGCACCATCAAAAGTGTTGTGGAGGCTTCTGTGCAGAAAGAGCGTCGTATGGGTGCTTCATTGCTACGCTTGCACTTCCATGATTGTTTTGTTAAT
GTAAGACATTCTACGCTTGTGGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAAGTAGTTATTTTGAGTGATGATGATAAGCTGATTCCTTACAAATTAAATGTGGTCAT
GGAATTCAAATCCTGACTTTTATATATGAGAAAAAAAATCAAGTTAGCAAGGAATTACTCATTTTTTAATGCCTTTAGATTTTTCGAAAACAAGTAGTCTCAGTATGTGACACAAAATAC
TCTTTAGTCTAAAAAAATAAATTCATACGGATTAATGAATGTATATATTACCTTAAAGACCCCATTATTTAAAATGTGGGGATTAATTTTTAGATGATGTGAAAATGTGAGGCTAATTAA
TGACTTGGTTTTGTGACGATGATTCAGGGTTGTGATGGTTCAATTCTTCTAGACTCCACATCCTCCATTGACAGCGAAAAGAATGCAGCTGCTAATTTGCAATCTGCTAGAGGATTTGAA
GTGGTGGATGACATAAAGAAAGCTGTGGACGAAGCATGTGGAAAACCAGTTGTTTCTTGCGCAGACATATTGGCTGTTGCAGCTCGTGATTCAGTTGTTGCG
GTGAGTAATAATACTGTA
ATGTAGCTTCAAAATTGTAATACTAGAATATAGCTAATTATAACCCAAAATGATATGCGTTAAATGTTTATCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAAATTATGCTTAATGTTATGAATTGTATTAGTCCATA
GCGAATTTTTTATTAATCACGATGTCAAATATACCAGAGATCATAAGATGATGCAATGCAATTTTTATAGAACTTTGACTGCATAAAAGTCAAATAAATGTATGTTACTAAAAAGTAATA
TAAACTTTATTAATTATCCAGGGAGTCAAGGACTCAGTTCGAATAGTATAAAAGTAAACCGGAGGATTTTTAACCGACCCACATAAATATGTAACGTTCAGAGCAAGTGTAGGGTAGGGT
AATTGTGATGGCCATATTACTACGAAATTTGAGAAATACAAAATGATTTTTATTAGTTAACTTTCAAAGACTTATATTTATCTGTATAACGAATTTTTACAACACTTTAGACCATATAAT
CTGTGTTTTTTATTACATAAATTATTTTATTATATATCCCTTATTTCTTATTTTATTTCTCTTTATTATTCAAAATCCTTTATATAAAAAATTGTTTAAATACAATTTCTCTTCCTCAAA
ATTCGTATAAATAATTACTAAATATTCTAGCTGAACAACACTATACTGTCATCTCTATATAAAAAATGAATGAACCTAGTTGTGAACAAGAATTAATTATGTGCATATGCTCCATGCAGT
TAGGGGGACCATCATGGAAGGTGAGACTTGGCAGAAGAGACTCTACTACAGCAAGTCGTGAAGCAGCAGATGCAAGCATTCCAGCACCATTTTTCAGCCTATCTGAACTCATCACCAACT
TCAAGAATCATGGTCTTGATGAGAAGGACCTTGTTGTTCTTTCTGGAGGCCACAGCATTGGATTTGCACGTTGTGTTACATTTAAGGACCATATCTACAATGACTCCAACATCGATCCCC
ACTTTGCACAACAACTTAAATACATTTGCCCTACAAACGGTGGTGACTCCAACCTTTCTCCTTTGGACTCAACAGCGGCAAAATTTGACATAAATTATTACTCTAATTTGGTTCAAAAGA
AAGGGCTTCTTCACTCTGATCAAGAACTCTTCAATGGTGGTTCTACTGATGAACTGGTCAAAGAGTACAGCGATGATACCGAAGATTTCTACGAGGACTTTGCGAACTCGATGATTAAGA
TGGGAAATATTCAGTCCCTCACTGGGAATCAAGGTGAAATTCGGGTTAACTGCAGGAATGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCACGTGGGTATTTCTTTGTTGTTCTCCATGCCTTAGTGTTTGCATCTATTGCAACCTCAGCTTTCTCACAATTGTCACCTAATTACTATGATTATTCGTGCCCTAAAGCTTTG
AGCACCATCAAAAGTGTTGTGGAGGCTTCTGTGCAGAAAGAGCGTCGTATGGGTGCTTCATTGCTACGCTTGCACTTCCATGATTGTTTTGTTAAT
GGTTGTGATGGTTCAATTCTTCTA
GACTCCACATCCTCCATTGACAGCGAAAAGAATGCAGCTGCTAATTTGCAATCTGCTAGAGGATTTGAAGTGGTGGATGACATAAAGAAAGCTGTGGACGAAGCATGTGGAAAACCAGTT
GTTTCTTGCGCAGACATATTGGCTGTTGCAGCTCGTGATTCAGTTGTTGCG
TTAGGGGGACCATCATGGAAGGTGAGACTTGGCAGAAGAGACTCTACTACAGCAAGTCGTGAAGCAGCA
GATGCAAGCATTCCAGCACCATTTTTCAGCCTATCTGAACTCATCACCAACTTCAAGAATCATGGTCTTGATGAGAAGGACCTTGTTGTTCTTTCTGGAGGCCACAGCATTGGATTTGCA
CGTTGTGTTACATTTAAGGACCATATCTACAATGACTCCAACATCGATCCCCACTTTGCACAACAACTTAAATACATTTGCCCTACAAACGGTGGTGACTCCAACCTTTCTCCTTTGGAC
TCAACAGCGGCAAAATTTGACATAAATTATTACTCTAATTTGGTTCAAAAGAAAGGGCTTCTTCACTCTGATCAAGAACTCTTCAATGGTGGTTCTACTGATGAACTGGTCAAAGAGTAC
AGCGATGATACCGAAGATTTCTACGAGGACTTTGCGAACTCGATGATTAAGATGGGAAATATTCAGTCCCTCACTGGGAATCAAGGTGAAATTCGGGTTAACTGCAGGAATGTGAACTAA

Retrieve as FASTA