Entry information : GmPrx132 (Glyma03g04750.1)
Entry ID 8952
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-23 (Christophe Dunand)
Peroxidase information: GmPrx132 (Glyma03g04750.1)
Name (synonym) GmPrx132 (Glyma03g04750.1)
Class Class III peroxidase    [Orthogroup: Prx040]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx132
start..stop
S start..stop
GmPrx130 579 0 1..319 1..319
GmPrx128 579 0 1..319 1..319
GmPrx129 577 0 1..319 1..319
GmPrx131 576 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4963798..4964013 216 N° 2 4963371..4963565 195 N° 3 4961637..4962191 555  
complement(join(4961637..4962191,4963371..4963565,4963798..4964013))


exon

Literature and cross-references GmPrx132 (Glyma03g04750.1)
DNA ref. Phytozome 12:   Gm03 (4964013..4961637)
Protein sequence: GmPrx132 (Glyma03g04750.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (296)
PWM (Da):   %s   35080.1 (32288.8)  
PI (pH):   %s   4.69 (4.54) Peptide Signal:   %s   cut: 26 range:26-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASHGYFSVLVHAFVFASLATSAFSQLSPNYYDYACPNALSTIKSVVEAAVQKEYRMGASLLRLHFHDCFVNGCDGSILLDPSPTIDSEKNAFANFQSVRGFEVVDDIKQAVDEACGTPVVSCADILAVAARDSVVALGGPTWEVQLGRRDSTTASKEAADANIPAPFFSLSQLITNFKNHGLDEKDLVVLSGGHTIGYARCVTFKDHIYNDSNIDPNFAQYLKYICPRNGGDLNLAPLDSTAANFDLNYYSNLVQKNGLLHSDQELFNGGSTDELVKQYSYDTEAFYVEFANSMVKMGNIQPLTGDQGEIRVSCRKVNNY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCACATGGGTATTTCTCTGTTCTTGTCCATGCCTTTGTGTTTGCAAGTCTTGCAACCTCAGCTTTCTCACAACTGTCACCTAATTACTATGATTATGCGTGCCCTAATGCTTTG
AGCACAATCAAAAGTGTCGTAGAGGCTGCGGTGCAGAAAGAGTACCGTATGGGGGCTTCTTTGCTACGCTTGCACTTCCATGATTGTTTTGTTAAC
GTAAGACTTTGTGTTTATGTACAT
CTAGGTTTGAAAACTATACCTTGATAATTAATAATCACATAATCATTTAAAAAAAATATTTATATCTATCTTTTAATTTCAATAACTCAAATAATTTAAATGATTTATATTTACTGTTTT
CATTTAATTGTCTCACTTAATATGATTTAATAATCCATATAATTTGAAATTTAACTAACAATTTCTAGGTTTTATAATGATGATTCAGGGTTGTGATGGTTCAATTCTACTAGACCCTTC
ACCCACCATTGACAGCGAAAAGAATGCATTTGCTAATTTTCAGTCTGTTAGAGGATTTGAAGTGGTTGATGACATCAAGCAAGCTGTGGACGAAGCATGTGGAACACCAGTTGTTTCTTG
CGCAGATATATTGGCTGTTGCCGCTCGTGACTCCGTGGTTGCG
GTGAGTAATACTGCAGCATTAATTAATACTAATTTTAACCCCAAATGCAATGTATTTATTAACTGTTGCTTATTATA
TTTAATATTTTCAAAATTAAATGTGTTTAAATCTATAAAAAAAAATATGTTTAAAGTCTGGTAATTCAATGTATTGATTTTTGTTTTCAATTCTTGTAATTTTATATACTTTAATATCTG
CAATATTCTTTGTTTTTGTTCCTAGCTATACCTTAAACACACACACATATATATNNNNNNNNNNNNNNNNNNNNNNNNGAAAGTATTTTAACGAATTGTGATTAATCTCTGTTATTTCAA
ATATAGTAAATTTGATTTTATATTCCTACAAAATATTAAAAAAATTATGTTTTAGCTTTTACATATTTATTGCTTTTAGTTCTTATCTTTATGTTGCTACAAAATATAAAACGATATTTG
TAATCCTTACCATGTGCTACAAAAAGGATAGTAAGAATTGAAAATAAATATATGTATATTATTTACGGAAATATAAAACATATTTAAATCATATTGTCATTATGCTTACAGTTTTGACTT
GAATTAGTCGACTGTGAAATACTTATATGTATTACTTAGGATAGGGGATGGGGTATAAGATGGTGAAATGCTGTTTTTTTTCTTCAATAAAAGTCAAAAGCCAAATAAATGTATTAAAAT
CCGTTATATAAATTTATTATCTAGGGACTCACTGACTCAGTCCGAATATTTACTAGTATTTAGAACTGGTGGATTCTCAATTCACCTATAACTGATCACAAAAGTTTTATTTCGTAATTG
TATTTGGGTCAAAGCGCATGTGGGGTGATTATGACAGGCCATATTCTAATGAGAATCGAGAATATAAAACCCTTAAGACATTCGACAGTTTTTTTAATGCATGTTTATAGAGTTTTTTTT
TAATACCAACCAAAAATTTTATAGTGTTTCTGTTACTCAAGTTCGTATAAATTCATAATATGCCCATGGTGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCATGCTGAATAGCACAGATATTTTTTCTTGTAACATATGAATGGAATATGTTGTGAACAATA
ATTATTTGCATGCGCCATGCAGTTAGGTGGGCCAACATGGGAGGTGCAACTGGGGAGAAGAGACTCCACCACAGCAAGCAAAGAAGCAGCAGATGCAAACATTCCAGCACCATTTTTCAG
CCTCTCTCAACTTATCACCAACTTCAAGAACCATGGTCTTGATGAGAAGGACCTTGTTGTTCTTTCTGGAGGCCACACAATTGGATATGCACGTTGTGTTACATTTAAGGACCATATTTA
CAATGACTCAAACATTGATCCCAACTTTGCACAATACCTTAAGTACATTTGCCCAAGAAATGGTGGTGACCTCAACCTTGCTCCTTTGGACTCAACAGCAGCGAACTTTGACCTAAACTA
TTACTCTAATTTGGTTCAAAAGAATGGCCTTCTTCACTCTGATCAGGAACTGTTTAATGGTGGTTCTACTGATGAACTGGTTAAACAGTACAGCTACGATACCGAAGCTTTCTATGTGGA
GTTCGCGAATTCGATGGTTAAAATGGGAAATATCCAGCCCCTTACTGGGGATCAAGGTGAAATTCGTGTTAGCTGTAGGAAAGTGAACAACTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCACATGGGTATTTCTCTGTTCTTGTCCATGCCTTTGTGTTTGCAAGTCTTGCAACCTCAGCTTTCTCACAACTGTCACCTAATTACTATGATTATGCGTGCCCTAATGCTTTG
AGCACAATCAAAAGTGTCGTAGAGGCTGCGGTGCAGAAAGAGTACCGTATGGGGGCTTCTTTGCTACGCTTGCACTTCCATGATTGTTTTGTTAAC
GGTTGTGATGGTTCAATTCTACTA
GACCCTTCACCCACCATTGACAGCGAAAAGAATGCATTTGCTAATTTTCAGTCTGTTAGAGGATTTGAAGTGGTTGATGACATCAAGCAAGCTGTGGACGAAGCATGTGGAACACCAGTT
GTTTCTTGCGCAGATATATTGGCTGTTGCCGCTCGTGACTCCGTGGTTGCG
TTAGGTGGGCCAACATGGGAGGTGCAACTGGGGAGAAGAGACTCCACCACAGCAAGCAAAGAAGCAGCA
GATGCAAACATTCCAGCACCATTTTTCAGCCTCTCTCAACTTATCACCAACTTCAAGAACCATGGTCTTGATGAGAAGGACCTTGTTGTTCTTTCTGGAGGCCACACAATTGGATATGCA
CGTTGTGTTACATTTAAGGACCATATTTACAATGACTCAAACATTGATCCCAACTTTGCACAATACCTTAAGTACATTTGCCCAAGAAATGGTGGTGACCTCAACCTTGCTCCTTTGGAC
TCAACAGCAGCGAACTTTGACCTAAACTATTACTCTAATTTGGTTCAAAAGAATGGCCTTCTTCACTCTGATCAGGAACTGTTTAATGGTGGTTCTACTGATGAACTGGTTAAACAGTAC
AGCTACGATACCGAAGCTTTCTATGTGGAGTTCGCGAATTCGATGGTTAAAATGGGAAATATCCAGCCCCTTACTGGGGATCAAGGTGAAATTCGTGTTAGCTGTAGGAAAGTGAACAAC
TATTGA

Retrieve as FASTA