Entry information : GmPrx133 (Glyma03g04760.1)
Entry ID 8953
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-23 (Christophe Dunand)
Peroxidase information: GmPrx133 (Glyma03g04760.1)
Name (synonym) GmPrx133 (Glyma03g04760.1)
Class Class III peroxidase    [Orthogroup: Prx040]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx133
start..stop
S start..stop
GmPrx96 582 0 1..319 1..319
GmPrx132 512 0 1..319 1..319
GmPrx129 504 0 1..319 1..319
GmPrx130 501 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4973889..4974104 216 N° 2 4973418..4973612 195 N° 3 4971994..4972542 549  
complement(join(4971994..4972542,4973418..4973612,4973889..4974104))


exon

Literature and cross-references GmPrx133 (Glyma03g04760.1)
DNA ref. Phytozome 12:   Gm03 (4974104..4971994)
Protein sequence: GmPrx133 (Glyma03g04760.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320
PWM (Da):   %s   35157.78 Transmb domain:   %s   i7-24o
PI (pH):   %s   8.71
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRKYFSIVIYAFILGAFANTAFSSLSRDYYDYSCPNALSTIRSVVEAAVQKERRMGASLLRTHFRDCFVNGCDGSILLDPSPTIDSEKSAVPDFQSDKAFKLVDEIKEAVDQACGKPVVSCADILTVAARDSVVALGGPTWEVRLGRRDSTIASRDAANANIPSPFFSLSELISNFKSHGLNEKDLVALSGGHTIGNARCATFRDHIYNDSNINPHFAKELKYICPREGGDSNIAPLDRTAAQFDSAYFRDLVHKKGLLRSDQELFNGGSTDALVKKYSHNTKVFRQDFAKSMIKMGNIKPLTGNRGEIRLNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCGCAAGTATTTCTCTATTGTTATCTATGCTTTTATACTTGGAGCTTTTGCAAATACGGCATTCTCATCATTGTCTCGTGATTACTATGACTACTCGTGCCCTAATGCTTTG
AGCACCATTAGAAGTGTTGTGGAGGCTGCGGTGCAGAAAGAGCGCCGTATGGGCGCATCCTTGCTACGCACACACTTCCGTGATTGTTTTGTTAAT
GTAAGACTTTATGTTTTTTTACTC
AATATATGATAGTTTGATGTTAGTTTGTTTAATTTTGTTAAAAATATCAAAATGAGATATTCAAACGGATAATTTTTCTATCTTCCTTTTCTCTTTACTCTTAAAGTTTCATTTTCAAAT
TACCAGACCAATCTTATATTTCTGTTAACTTAAAACTCTCTATACTAGTGTTATTTATACATGTATAGTAGGTTCTTGATGTAATTTTTGTCTGATGAATCACTTGGTTTTGTAATCATG
GTGACTGATCAGGGTTGTGATGGTTCAATTCTACTAGACCCTTCACCAACAATTGACAGCGAAAAGAGTGCAGTTCCTGATTTTCAATCCGACAAAGCATTTAAATTGGTGGATGAGATC
AAAGAGGCTGTGGACCAAGCATGTGGAAAACCAGTTGTTTCTTGCGCTGACATATTGACTGTTGCCGCTCGTGACTCTGTCGTTGCG
GTTAGTGATACTACACACTACTAATAATAATTA
ATGATAGAATCCTTATTTGAGCATCTCATCCTTTTAAAATTCTAATTGATGATGAGATATTACAAGATAAAGAGAAATGAGAAATATTGGTTGGTTGTTTGTAAATTATAGATGTCCAAA
TTTTAACATTTTATTCTATATTTAATTGTGATTAATATTTTGTATTAATTTAGTCGATAGTTCAATTTTTATACCATTCGGCTACCATGGCAAATAGAGCAAGAACTGGTAAACCAAACA
ATTGTAATAAATTTCTTTTTGATTTTCTGACTCAGTAAATATAAGATGTTTAAATATAAAAAATAGAACTATGAATATTTTACAACATAGTTTTTCATACTTACCTTTACACCAATTAAA
AAAAGTATGTCACTATCAATCCTATGCCCGCAGATTAAATTTATTCATAAAAAGTAGGGAAAATGGAACAATCATGGGTGACATAAAACCAACATAAACAAGTTTAACAAAAACCTATAA
TTAGACATATTTAACTCATCTCTAAGAAAGTGATTACAAATGAAACTTGGGACCAATTCCCACCAAATAAATTCCTGTGAGTGTAAACCATGATCTGCTAACCTACCAGCAAAAAAAAAA
AAAATCCTTTCACGAAAATGTGAAAAGAAATCCACTTAATGAAAGACAAGCATAATAACATAAGAATATTATATGAATAAATGTAACACTATAGTTATTTGAGTGTGATCAAGTGGTTTG
ATTTAGTCATTTAGACATCCATCCTGCATGACCTAATGAAATTTGAATGCATATAATAACATAAGAAGTTGTTTTTAATTAGTAACATGTAACATTAACAATTATGTGCATGCCCCATGC
AGCTAGGGGGACCAACATGGGAGGTGAGACTGGGGAGAAGAGACTCCACCATAGCAAGCCGTGATGCAGCAAATGCAAACATTCCATCACCATTTTTCAGCCTTTCTGAGCTCATAAGCA
ACTTCAAGAGCCATGGACTAAACGAGAAGGACCTTGTTGCTCTTTCTGGAGGCCACACAATTGGAAATGCACGTTGTGCTACCTTTAGGGACCATATCTACAATGACTCTAATATCAATC
CACATTTTGCAAAAGAGCTCAAATACATTTGTCCTAGAGAAGGAGGTGACTCCAACATTGCTCCTTTGGACCGCACAGCAGCGCAATTTGATTCAGCCTATTTTCGTGACTTGGTTCACA
AGAAAGGGCTTCTTCGCTCCGATCAGGAACTGTTCAATGGTGGTTCTACTGATGCATTGGTAAAAAAATATAGCCACAATACCAAGGTTTTCCGCCAGGACTTCGCAAAATCTATGATTA
AGATGGGAAACATAAAGCCTCTTACCGGGAATAGAGGTGAAATTCGTTTGAACTGCAGGAGAGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCGCAAGTATTTCTCTATTGTTATCTATGCTTTTATACTTGGAGCTTTTGCAAATACGGCATTCTCATCATTGTCTCGTGATTACTATGACTACTCGTGCCCTAATGCTTTG
AGCACCATTAGAAGTGTTGTGGAGGCTGCGGTGCAGAAAGAGCGCCGTATGGGCGCATCCTTGCTACGCACACACTTCCGTGATTGTTTTGTTAAT
GGTTGTGATGGTTCAATTCTACTA
GACCCTTCACCAACAATTGACAGCGAAAAGAGTGCAGTTCCTGATTTTCAATCCGACAAAGCATTTAAATTGGTGGATGAGATCAAAGAGGCTGTGGACCAAGCATGTGGAAAACCAGTT
GTTTCTTGCGCTGACATATTGACTGTTGCCGCTCGTGACTCTGTCGTTGCG
CTAGGGGGACCAACATGGGAGGTGAGACTGGGGAGAAGAGACTCCACCATAGCAAGCCGTGATGCAGCA
AATGCAAACATTCCATCACCATTTTTCAGCCTTTCTGAGCTCATAAGCAACTTCAAGAGCCATGGACTAAACGAGAAGGACCTTGTTGCTCTTTCTGGAGGCCACACAATTGGAAATGCA
CGTTGTGCTACCTTTAGGGACCATATCTACAATGACTCTAATATCAATCCACATTTTGCAAAAGAGCTCAAATACATTTGTCCTAGAGAAGGAGGTGACTCCAACATTGCTCCTTTGGAC
CGCACAGCAGCGCAATTTGATTCAGCCTATTTTCGTGACTTGGTTCACAAGAAAGGGCTTCTTCGCTCCGATCAGGAACTGTTCAATGGTGGTTCTACTGATGCATTGGTAAAAAAATAT
AGCCACAATACCAAGGTTTTCCGCCAGGACTTCGCAAAATCTATGATTAAGATGGGAAACATAAAGCCTCTTACCGGGAATAGAGGTGAAATTCGTTTGAACTGCAGGAGAGTGAACTAA

Retrieve as FASTA