Entry information : GmPrx162 (Glyma06g45920.1)
Entry ID 8963
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-10 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx162 (Glyma06g45920.1)
Name (synonym) GmPrx162 (Glyma06g45920.1)
Class Class III peroxidase    [Orthogroup: Prx139]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx162
start..stop
S start..stop
GmPrx10 584 0 1..325 1..324
GmPrx45 584 0 1..325 1..324
PvPrx12 577 0 1..325 1..325
MtPrx53 568 0 1..324 3..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 48648217..48648426 210 N° 2 48647917..48648108 192 N° 3 48647102..48647264 163 N° 4 48646105..48646517 413
complement(join(48646105..48646517,48647102..48647264,48647917..48648108,4864821 7..48648426))


exon

Literature and cross-references GmPrx162 (Glyma06g45920.1)
DNA ref. Phytozome 12:   Gm06 (48648426..48646105)
Protein sequence: GmPrx162 (Glyma06g45920.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   35381.2 (32802.8)  
PI (pH):   %s   8.21 (8.21) Peptide Signal:   %s   cut: 24 range:24-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MESQSYFKALIIILIALIGSTQAQLQLGFYAKSCPKAEKIILKYVVEHIRNAPSLAAALIRMHFHDCFVNGCDGSVLVNSTQGNQAEKDSPPNLTLRGFGFIDTIKSVVEAECPGVVSCADILALTARDSVHSIGGPYWNVPTGRRDGVISKAEEALLSLPAPFHNLTTLLTLFGNVGLDVNDLVLLSGAQTIGVSHCSSIATRLYNFTGKGDTDPTLDNEYAKNLKTFKCKNINDNTTLIEMDPGSRNTFDLGYFKQVVKRRGLFQSDAALLESSTTRAIIARQLQSTQGFFAEFAKSMEKMGRINVKTGTEGEIRKQCARVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from Phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGCCAGAGTTACTTCAAGGCTTTGATTATTATTCTTATAGCACTAATTGGATCAACTCAAGCTCAGTTGCAGCTTGGTTTCTATGCCAAAAGCTGTCCAAAGGCTGAGAAAATA
ATTTTGAAGTATGTTGTTGAGCATATCCGAAATGCTCCATCACTAGCAGCTGCTCTCATAAGAATGCACTTCCACGATTGTTTTGTCAAT
GTATGCACATAATTTATGTTTCATTTTCTA
GTCAATGGCTATTTTGTTAAAGTTAGGAGGTATGATTTAATGTAACATTAACATGTAGTATATATTAATTAATTTCAGGGTTGTGATGGATCAGTGCTTGTGAACTCAACACAAGGCAAT
CAAGCTGAAAAGGATTCTCCTCCAAATCTTACTCTTCGAGGCTTTGGCTTCATTGACACAATAAAGAGTGTTGTTGAAGCTGAATGCCCTGGTGTAGTCTCTTGCGCTGATATCCTGGCT
TTGACTGCCAGAGACTCTGTTCATTCCATT
GTAAGTACTTGTTTCATCCTCATCTCTAAGGAAATATGGTCACTTAGAATAATAGTTAATCTGTATCCAACATGTATTCAAAATGTAATA
TAATTTCCAGCAAAGCAAGGAAAACTTTCTGGCAATAAGTGAGTTTGTGTTAAGTAGTAAAAGTAAAAGAAAGAAAAGAAATTAGAGTCATTGAAATACATGCTGTTTGTTTGGTTTTAT
TTTTGGGAAGATTGTGAGTATAGAATTGATTCTGCATAAATTTTTATATGTTTAGTTTTATGTTAGAGAATAATTTATAATTATAGATTGAAGTAATTTTGAGTAGGTCATGTGTTGATA
AAAAATTTATATTAAATTTTACCGTCAAATTTACTTTATAATAAAAATATTTAAACATAAATCAAATTACTTTCTAAATCAATTTTATGAACTCCATTCAAACATTCAAACCCACGTACG
CATAGATGAACCAAGACAATTAGAATCAAATAATAATTTAGAGAATGAATGGTGAAAAAGTGATGTGCAAGAGTACTGGCTAGGTGTTAAGTTATATATAGTTAAATATCCATATTTGTG
TCATGTTTTCTCAAGGCTTTCTTTTATAGAATAGAAATGAAATGGCCCATGTTGTTATTCTGCCATTGTCTTGTGTTTGCAGGGTGGACCCTATTGGAATGTTCCAACAGGTCGAAGGGA
CGGGGTAATCTCTAAAGCAGAAGAGGCATTGCTTAGCTTGCCTGCTCCATTTCACAACCTCACTACCCTCCTAACACTCTTTGGCAATGTTGGACTTGATGTAAACGACCTTGTCTTGCT
TTCTG
GTATGTCAAAATTCTTTAGTTTTGTACTATAAATTAGGTTTAAATATGTTTTTAACCTTTAAATTTAAGATAAGTTTATTTTTGTCCTTAAAATTTAAAAATTGATATTTAATTT
TTGAAAAAAAATTGTTTTAGTCCCTCCCTCCAAATACCCTATTTCCGAATGCTGTCAAAATAAATACTTTGAAAGGAAAACATGCATGTGAGGTTTTTGATAATAAGAATACAAAATCAA
AATAGGTTGTCACATAAATATCTTGTACGTAATTTATTAGCTATGTAAGCAAATCTTTAACGATATTTGGACGAATGGATTAAAATCAACTTTTTAAAAATTACAGGACTAGAAGGATGA
ATATTAAATTTGAAAGACAAAAAATTAATTTACTCTAAATTTAAAAGACTAAAAACATATTTAAATCTGAAAGTTAACATTAAAGGAACATAAGTTATCATGGTAAAGCACTAATTTTGA
TTGTACAATATCAAAATCATGTAAGAAAATTATATGTAAGTTTTGTCATTTTCTTTGTTACACATTTTAATTTCTTTGATCCTAATCACCAAAGATTCAATTTCCTTAGGTGCTCAAACT
ATTGGTGTTTCTCATTGTTCTTCAATTGCAACCCGTTTATACAATTTTACGGGTAAGGGTGACACTGATCCAACTCTGGATAATGAATATGCAAAAAATCTTAAGACCTTTAAGTGCAAG
AACATCAATGACAACACTACACTTATTGAGATGGACCCGGGAAGTCGGAACACATTTGATCTTGGTTATTTTAAACAAGTGGTTAAGAGAAGGGGTTTGTTTCAATCAGATGCTGCATTG
CTTGAAAGTTCTACCACAAGAGCTATTATTGCCAGACAACTTCAATCAACTCAAGGATTTTTTGCAGAATTTGCCAAGTCCATGGAAAAAATGGGACGAATTAATGTCAAGACTGGAACA
GAAGGAGAAATAAGGAAACAATGTGCACGAGTAAATAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAGCCAGAGTTACTTCAAGGCTTTGATTATTATTCTTATAGCACTAATTGGATCAACTCAAGCTCAGTTGCAGCTTGGTTTCTATGCCAAAAGCTGTCCAAAGGCTGAGAAAATA
ATTTTGAAGTATGTTGTTGAGCATATCCGAAATGCTCCATCACTAGCAGCTGCTCTCATAAGAATGCACTTCCACGATTGTTTTGTCAAT
GGTTGTGATGGATCAGTGCTTGTGAACTCA
ACACAAGGCAATCAAGCTGAAAAGGATTCTCCTCCAAATCTTACTCTTCGAGGCTTTGGCTTCATTGACACAATAAAGAGTGTTGTTGAAGCTGAATGCCCTGGTGTAGTCTCTTGCGCT
GATATCCTGGCTTTGACTGCCAGAGACTCTGTTCATTCCATT
GGTGGACCCTATTGGAATGTTCCAACAGGTCGAAGGGACGGGGTAATCTCTAAAGCAGAAGAGGCATTGCTTAGCTTG
CCTGCTCCATTTCACAACCTCACTACCCTCCTAACACTCTTTGGCAATGTTGGACTTGATGTAAACGACCTTGTCTTGCTTTCTG
GTGCTCAAACTATTGGTGTTTCTCATTGTTCTTCA
ATTGCAACCCGTTTATACAATTTTACGGGTAAGGGTGACACTGATCCAACTCTGGATAATGAATATGCAAAAAATCTTAAGACCTTTAAGTGCAAGAACATCAATGACAACACTACACTT
ATTGAGATGGACCCGGGAAGTCGGAACACATTTGATCTTGGTTATTTTAAACAAGTGGTTAAGAGAAGGGGTTTGTTTCAATCAGATGCTGCATTGCTTGAAAGTTCTACCACAAGAGCT
ATTATTGCCAGACAACTTCAATCAACTCAAGGATTTTTTGCAGAATTTGCCAAGTCCATGGAAAAAATGGGACGAATTAATGTCAAGACTGGAACAGAAGGAGAAATAAGGAAACAATGT
GCACGAGTAAATAGCTAA

Retrieve as FASTA