Entry information : GmPrx167 (Glyma08g17300.1)
Entry ID 8967
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-26 (Christophe Dunand)
Peroxidase information: GmPrx167 (Glyma08g17300.1)
Name (synonym) GmPrx167 (Glyma08g17300.1)
Class Class III peroxidase    [Orthogroup: Prx097]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx167
start..stop
S start..stop
GmPrx[P]269 612 0 15..340 5..328
MtPrx18 565 0 1..340 1..335
PpePrx49 465 3e-166 45..339 41..336
CsaPrx34 447 4e-159 34..338 24..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12810346..12810618 273 N° 2 12811586..12812335 750  
join(12810346..12810618,12811586..12812335)


exon

Literature and cross-references GmPrx167 (Glyma08g17300.1)
DNA ref. Phytozome 12:   Gm08 (12810346..12812335)
Protein sequence: GmPrx167 (Glyma08g17300.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (318)
PWM (Da):   %s   37746.8 (35061.3)  
PI (pH):   %s   8.73 (8.74) Peptide Signal:   %s   cut: 23 range:23-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRLHYLTLFLLLVPLELSTIYGLSTQGNVPKKSSIKPLLPPPEALLSIGHYHTTCPDAEGIISQKVAAWVKKDPTLAPAIIRLHFHDCAVMGCDASILLNHPGSERTALESRTLRGFQLIDDIKSELEKKCPRTVSCADILTAAARDATLLAGGPFWEVPFGRKDGKISLAREANLVPHGHENITALITFFQERGLDILDLVTLSGSHTIGRSTCSSIMDRIYNFNGTKKPDPSLNVFFLKLLRKRCKRVMDLVHLDVITPRTFDTTYYTNLMRKVGLLSTDQSLFSDARTAPFVEAFATQPFLFTSQFSVSMVKLGNVQVLTRPNEGEIRVNCNYVNTV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCTCCACTACCTTACCCTTTTCCTCCTTTTGGTCCCTTTGGAGTTGAGCACCATTTATGGTCTCTCTACACAAGGAAATGTGCCTAAGAAATCATCCATCAAGCCCTTATTACCA
CCCCCTGAGGCCTTGCTGTCCATTGGTCACTATCACACAACATGTCCTGATGCTGAAGGCATCATCTCACAAAAGGTTGCTGCTTGGGTTAAGAAGGACCCTACATTGGCCCCTGCCATC
ATACGCCTTCATTTCCATGACTGTGCTGTTATG
GTAATTAATCACATGACTCAATCTCTTTCTTTAAATTTGGCAATGTGTGTTTCCTATGTTTGTTTCTTGCTTAGTTGAAATAAGGTA
CACTTGAATTGGCCACATGCATCTTGATTCATGCATGCATCACTGATCACTTTAACTTGCTACGTGTCATTAGATACATATGATGACCATTAGAAAAAAGAGGTTTTGTGTTTTTTTGGA
GATTAATTTGGATCATTTTGAGTTTTTGACTATTGTAGCCAAACATGGTTAAAATCCAGCATCTAAAGTACATTGTCATTATAAAGTCTTTTATACTGTTATCTAATTACAAATCATTTT
CGATATGAATTTTACTGTAATTATTATTAAGTTAATAATCTTACCATACATTACCAATCATGATTAGATTGGAATTAAAAATATACAAGGATAACATGGTAATCTGTTACAGGACATTTT
TATATGATGTTCATAACAACTGTGACTGAACGTTGTTGGGACCGAAGCCAACTTCTGGTTTGGGAATTGGATCACATGCAAATCTTGGTCTCTTCATTGTCTCGATGATGACAATCAAAA
CTTACTTGAAACACATACAATAAATAACCGGACCCTGGTGCTACCATTTGCATTTTTATTTCTCCAACATCATTAACCTTCTATTCCTCACTTTTACACTATTTTTAAGTCATTATTTTA
CTTCATAGAAAAAAAATTAATTACTTTTATTATCTAAAATGAAGTGAATTACATTTTAGTAATATTAGTCTCTCTCACACACATTATTAGTAAATAGTTATACGCATGTAAATAGATGAC
AGCTTAAAAAACATTCAGAGTGCCAGACCTAACTATATTAACTTATAGATTATGATTTAACATTTTGATATTGTTATTAAAAGTGTTGACTTGAAGTGAGTTGTGAATGTTTCATGAATC
ACTTTGTTTGATGCACTTCAATTGATCAAATTCAATGCAGGGATGCGATGCATCAATATTGCTCAACCATCCAGGGAGTGAGAGGACTGCATTAGAGAGCAGAACCCTGAGAGGATTCCA
ATTGATTGATGATATCAAGAGTGAGTTAGAAAAAAAGTGTCCAAGGACAGTCTCTTGTGCTGACATTCTTACTGCAGCAGCTAGAGATGCCACTCTTTTGGCTGGAGGACCATTCTGGGA
AGTCCCATTTGGCAGAAAAGATGGCAAGATTTCCTTAGCCAGAGAGGCCAATTTGGTCCCTCATGGCCATGAAAACATAACAGCCCTTATTACATTCTTTCAAGAAAGAGGTTTAGACAT
TCTTGACTTGGTCACTCTCTCAGGCTCACACACAATTGGGAGGAGCACTTGTTCTTCTATCATGGATAGGATTTACAACTTCAATGGGACTAAAAAGCCAGATCCCTCACTAAATGTCTT
TTTCTTGAAGTTGTTGAGGAAAAGGTGCAAAAGGGTGATGGATTTGGTGCACCTTGATGTCATAACCCCTAGGACTTTTGACACAACCTATTACACTAACCTTATGAGGAAAGTGGGGTT
ATTGTCAACAGATCAGTCACTTTTTTCAGATGCAAGGACTGCTCCTTTTGTTGAAGCATTTGCAACACAACCTTTTCTTTTCACTAGCCAGTTTTCAGTGTCAATGGTGAAGCTTGGGAA
TGTTCAAGTTCTGACTAGGCCTAATGAAGGTGAAATAAGGGTTAATTGCAATTATGTCAATACTGTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCTCCACTACCTTACCCTTTTCCTCCTTTTGGTCCCTTTGGAGTTGAGCACCATTTATGGTCTCTCTACACAAGGAAATGTGCCTAAGAAATCATCCATCAAGCCCTTATTACCA
CCCCCTGAGGCCTTGCTGTCCATTGGTCACTATCACACAACATGTCCTGATGCTGAAGGCATCATCTCACAAAAGGTTGCTGCTTGGGTTAAGAAGGACCCTACATTGGCCCCTGCCATC
ATACGCCTTCATTTCCATGACTGTGCTGTTATG
GGATGCGATGCATCAATATTGCTCAACCATCCAGGGAGTGAGAGGACTGCATTAGAGAGCAGAACCCTGAGAGGATTCCAATTGATT
GATGATATCAAGAGTGAGTTAGAAAAAAAGTGTCCAAGGACAGTCTCTTGTGCTGACATTCTTACTGCAGCAGCTAGAGATGCCACTCTTTTGGCTGGAGGACCATTCTGGGAAGTCCCA
TTTGGCAGAAAAGATGGCAAGATTTCCTTAGCCAGAGAGGCCAATTTGGTCCCTCATGGCCATGAAAACATAACAGCCCTTATTACATTCTTTCAAGAAAGAGGTTTAGACATTCTTGAC
TTGGTCACTCTCTCAGGCTCACACACAATTGGGAGGAGCACTTGTTCTTCTATCATGGATAGGATTTACAACTTCAATGGGACTAAAAAGCCAGATCCCTCACTAAATGTCTTTTTCTTG
AAGTTGTTGAGGAAAAGGTGCAAAAGGGTGATGGATTTGGTGCACCTTGATGTCATAACCCCTAGGACTTTTGACACAACCTATTACACTAACCTTATGAGGAAAGTGGGGTTATTGTCA
ACAGATCAGTCACTTTTTTCAGATGCAAGGACTGCTCCTTTTGTTGAAGCATTTGCAACACAACCTTTTCTTTTCACTAGCCAGTTTTCAGTGTCAATGGTGAAGCTTGGGAATGTTCAA
GTTCTGACTAGGCCTAATGAAGGTGAAATAAGGGTTAATTGCAATTATGTCAATACTGTCTAA

Retrieve as FASTA