Entry information : GmPrx192 (Glyma10g01250.1)
Entry ID 8981
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-12-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-11-18 (Christophe Dunand)
Peroxidase information: GmPrx192 (Glyma10g01250.1)
Name (synonym) GmPrx192 (Glyma10g01250.1)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx192
start..stop
S start..stop
GmPrx332 674 0 1..324 1..324
GmPrx106 604 0 5..324 3..319
RcPrx02 472 3e-169 24..324 28..331
LjPrx55 470 2e-168 4..324 5..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 904255..904473 219 N° 2 904587..905342 756  
join(904255..904473,904587..905342)


exon

Literature and cross-references GmPrx192 (Glyma10g01250.1)
DNA ref. Phytozome 12:   Gm10 (904255..905342)
Protein sequence: GmPrx192 (Glyma10g01250.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (298)
PWM (Da):   %s   35084.52 (32291.9)  
PI (pH):   %s   8.03 (7.78) Peptide Signal:   %s   cut: 27 range:27-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARFLHMLIMLSSLALIISVLPLASASLKVDFYKTTCPSAEAIVKRAVNKAVSLNPGIAAGLIRMHFHDCFVRGCDGSVLLESTQGNPSEREHPANNPSLRGFEVIDEAKAEIEAECPHTVSCADILAFAARDSSNKVGGINYVVPAGRRDGRVSNRDEASQLPRPTFNTQQLISNFEQKGLSADEMVTLSGAHSIGVSHCSSFSDRLYSFNATFPQDPSMDTKFATSLKSKCPPRSDNTVELDASSPNRLDNNYYTMLNNHRGLLTSDQTLLTSPSTRPMVLTNAKHGSTWARKFAKAMVHMGSIEVLTGSQGEIRTRCSVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron1) andem duplication of gene ID 9964.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGATTTCTACACATGCTTATAATGCTCTCTAGCCTTGCTCTAATTATCTCAGTTTTGCCATTGGCCTCCGCATCTTTGAAGGTGGACTTCTATAAAACTACGTGCCCATCTGCA
GAGGCAATAGTGAAAAGAGCCGTAAACAAAGCCGTTTCTCTCAACCCGGGCATCGCTGCTGGTTTGATAAGAATGCATTTTCATGATTGTTTTGTGAGG
GTAAGTATTTCATCTTCATAT
ATATATATATATCAATTCATTAGTCATGTGTAGTGCACATCCATTTCTGAAATTGATGCTTAATTAATTGCTATATTATATAATATGTGCAGGGTTGTGATGGTTCTGTGCTATTAGAAT
CCACCCAAGGCAACCCATCAGAGAGAGAGCACCCTGCCAACAACCCAAGTTTACGTGGCTTTGAAGTTATCGATGAAGCCAAGGCTGAAATAGAGGCAGAGTGTCCTCACACTGTGTCCT
GTGCAGACATTCTTGCCTTTGCTGCTCGAGACAGCTCCAACAAAGTTGGAGGCATAAACTATGTAGTGCCAGCTGGACGCAGAGATGGTCGTGTCTCTAACAGAGACGAAGCTTCACAAC
TTCCTCGTCCAACATTCAACACACAACAACTCATTAGTAACTTTGAACAAAAAGGGTTGTCTGCAGATGAAATGGTAACACTCTCTGGAGCACATTCTATTGGTGTCTCACATTGTTCCT
CCTTCTCCGACCGCTTGTACTCTTTCAATGCCACGTTTCCTCAAGACCCTTCTATGGACACTAAATTTGCCACGTCGTTGAAAAGCAAGTGTCCACCAAGGAGTGATAACACGGTGGAGC
TTGATGCTTCCTCGCCTAACCGTTTGGACAACAACTACTACACGATGCTCAATAACCATCGTGGTTTGTTGACCTCAGATCAGACTTTGTTGACCAGCCCCTCAACGAGGCCAATGGTGC
TAACCAATGCTAAACATGGTTCGACATGGGCACGCAAGTTTGCTAAGGCAATGGTGCATATGGGTTCCATTGAAGTGCTAACTGGCTCACAAGGAGAGATCAGAACGCGTTGCAGCGTCG
TTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGATTTCTACACATGCTTATAATGCTCTCTAGCCTTGCTCTAATTATCTCAGTTTTGCCATTGGCCTCCGCATCTTTGAAGGTGGACTTCTATAAAACTACGTGCCCATCTGCA
GAGGCAATAGTGAAAAGAGCCGTAAACAAAGCCGTTTCTCTCAACCCGGGCATCGCTGCTGGTTTGATAAGAATGCATTTTCATGATTGTTTTGTGAGG
GGTTGTGATGGTTCTGTGCTA
TTAGAATCCACCCAAGGCAACCCATCAGAGAGAGAGCACCCTGCCAACAACCCAAGTTTACGTGGCTTTGAAGTTATCGATGAAGCCAAGGCTGAAATAGAGGCAGAGTGTCCTCACACT
GTGTCCTGTGCAGACATTCTTGCCTTTGCTGCTCGAGACAGCTCCAACAAAGTTGGAGGCATAAACTATGTAGTGCCAGCTGGACGCAGAGATGGTCGTGTCTCTAACAGAGACGAAGCT
TCACAACTTCCTCGTCCAACATTCAACACACAACAACTCATTAGTAACTTTGAACAAAAAGGGTTGTCTGCAGATGAAATGGTAACACTCTCTGGAGCACATTCTATTGGTGTCTCACAT
TGTTCCTCCTTCTCCGACCGCTTGTACTCTTTCAATGCCACGTTTCCTCAAGACCCTTCTATGGACACTAAATTTGCCACGTCGTTGAAAAGCAAGTGTCCACCAAGGAGTGATAACACG
GTGGAGCTTGATGCTTCCTCGCCTAACCGTTTGGACAACAACTACTACACGATGCTCAATAACCATCGTGGTTTGTTGACCTCAGATCAGACTTTGTTGACCAGCCCCTCAACGAGGCCA
ATGGTGCTAACCAATGCTAAACATGGTTCGACATGGGCACGCAAGTTTGCTAAGGCAATGGTGCATATGGGTTCCATTGAAGTGCTAACTGGCTCACAAGGAGAGATCAGAACGCGTTGC
AGCGTCGTTAATTAA

Retrieve as FASTA