Entry information : GmPrx203 (Glyma11g06180.1)
Entry ID 8986
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-26 (Christophe Dunand)
Peroxidase information: GmPrx203 (Glyma11g06180.1)
Name (synonym) GmPrx203 (Glyma11g06180.1)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx203
start..stop
S start..stop
GmPrx103 634 0 1..327 1..327
LjPrx36 564 0 10..327 9..326
MtPrx52 549 0 1..327 1..326
MtPrx58 546 0 1..327 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4376360..4376578 219 N° 2 4376070..4376261 192 N° 3 4375533..4375695 163 N° 4 4375016..4375425 410
complement(join(4375016..4375425,4375533..4375695,4376070..4376261,4376360..4376 578))


exon

Literature and cross-references GmPrx203 (Glyma11g06180.1)
DNA ref. Phytozome 12:   Gm11 (4376578..4375016)
Protein sequence: GmPrx203 (Glyma11g06180.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (301)
PWM (Da):   %s   35759.9 (32598.4)  
PI (pH):   %s   6.27 (6.74) Peptide Signal:   %s   cut: 27 range:27-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEFTSNNMLPFVSMFWLVFLSPLVNCQLYYNFYDSTCPNLTGIVRSNVWSAMAKDARIAASLLRLHFHDCFVIGCDASVLLDDTGTLKGEKNALPNKNSLRGFEVIDTIKSALEKACPSTVSCADILALAAREAVNLSKGTFWYVPLGRRDGTTASESEANNLPSPFEPIENITAKFISKGLEKKDVAVLSGAHTLGFAQCFTFKPRLFDFGGSGKSDPALDVSLLQNLVKLCPNQADSDTNLAPLDPVTTNTFDNMYYKNIVNNSGLLQSDQALLGDSTTASLVNTYSKWPLMFFRDFGISMEKMGRIGVLTGSQGQIRTNCRAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTTACCTCTAATAATATGCTTCCTTTTGTTTCAATGTTTTGGCTTGTGTTCCTAAGTCCTTTAGTGAACTGTCAACTTTATTATAATTTCTATGACTCAACTTGTCCAAACCTG
ACCGGAATTGTTCGATCCAACGTGTGGTCAGCTATGGCCAAGGATGCAAGAATTGCTGCTTCTCTCTTGCGCCTTCATTTCCATGATTGTTTTGTCATT
GTAAATATATAAGCTGTCTCA
ATTTTAGTTATTCTTTTAGTTGGGATAATTTTATAGATTTTTTACATGTGCTGCTTCTTTCATTTTTTGTTACAAAGGGATGTGATGCATCTGTGCTACTTGATGATACGGGCACTTTAA
AGGGGGAGAAAAACGCACTGCCTAATAAAAATTCACTCAGAGGATTTGAGGTCATTGACACAATCAAGTCTGCATTGGAGAAGGCTTGTCCATCCACTGTGTCATGTGCTGATATACTTG
CTCTAGCGGCAAGAGAAGCTGTTAATCTT
GTAAGACACCAATTTTTAACTATTTGGAATATAGTATTTAATATATGATATTAGAAATGCATGGATGCAGTTGCAACAACTTTCCTGTTTA
TCGTTTAAAACGTTCTATTTTGATCCTATAGTTAGAATTATTTTTACCTTTTAGTTCTACCCGTCTAATGAATGTGACACAACTCATGTAATTTGCATTCATCTCAAACAACATTAGACG
GGACTAAAAGATAAAGAGGGGTAATTGTAGAGATCAAATGATAGAGTAATTAAACAAACAAAAAAAATATTTAATAGTTGGTTATTTGATTTTGGTCATAGTTTAATCATATTGAATGTA
TACATCAAATCAAACATATTAAAACCTTTGGTAATATTTTCAGAGTAAAGGTACATTTTGGTATGTGCCTCTGGGTCGTAGAGATGGTACAACAGCAAGTGAGAGCGAGGCAAATAACTT
GCCATCACCCTTTGAACCTATAGAAAACATTACCGCCAAGTTTATATCCAAGGGTCTTGAAAAGAAGGATGTGGCAGTACTCTCAG
GTTGGCTAATTAATACTTCCTTCACATTTATATT
ATATGCTTCAGTCTTGCAGGCTAATCATAAGACCAAGTTTACAAATATTCATGTCTATGTAACGAATGTATAGGTGCACACACTCTTGGCTTTGCTCAATGCTTCACGTTCAAGCCTAGG
CTCTTCGACTTTGGTGGCTCTGGTAAATCTGATCCAGCACTTGATGTTTCACTCCTACAAAATTTAGTGAAACTGTGTCCAAATCAAGCTGACTCTGACACCAATTTGGCTCCCTTGGAT
CCCGTCACCACCAACACATTTGATAACATGTATTACAAAAACATTGTGAACAATTCGGGGCTGCTTCAGTCAGACCAGGCTCTTTTGGGTGACAGCACCACTGCTTCACTGGTCAACACG
TATAGCAAGTGGCCTCTTATGTTCTTCAGAGACTTTGGAATATCTATGGAGAAAATGGGTCGCATAGGTGTACTCACAGGATCACAGGGGCAAATAAGAACAAACTGTAGGGCTGTTAAC
TAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTTACCTCTAATAATATGCTTCCTTTTGTTTCAATGTTTTGGCTTGTGTTCCTAAGTCCTTTAGTGAACTGTCAACTTTATTATAATTTCTATGACTCAACTTGTCCAAACCTG
ACCGGAATTGTTCGATCCAACGTGTGGTCAGCTATGGCCAAGGATGCAAGAATTGCTGCTTCTCTCTTGCGCCTTCATTTCCATGATTGTTTTGTCATT
GGATGTGATGCATCTGTGCTA
CTTGATGATACGGGCACTTTAAAGGGGGAGAAAAACGCACTGCCTAATAAAAATTCACTCAGAGGATTTGAGGTCATTGACACAATCAAGTCTGCATTGGAGAAGGCTTGTCCATCCACT
GTGTCATGTGCTGATATACTTGCTCTAGCGGCAAGAGAAGCTGTTAATCTT
AGTAAAGGTACATTTTGGTATGTGCCTCTGGGTCGTAGAGATGGTACAACAGCAAGTGAGAGCGAGGCA
AATAACTTGCCATCACCCTTTGAACCTATAGAAAACATTACCGCCAAGTTTATATCCAAGGGTCTTGAAAAGAAGGATGTGGCAGTACTCTCAG
GTGCACACACTCTTGGCTTTGCTCAA
TGCTTCACGTTCAAGCCTAGGCTCTTCGACTTTGGTGGCTCTGGTAAATCTGATCCAGCACTTGATGTTTCACTCCTACAAAATTTAGTGAAACTGTGTCCAAATCAAGCTGACTCTGAC
ACCAATTTGGCTCCCTTGGATCCCGTCACCACCAACACATTTGATAACATGTATTACAAAAACATTGTGAACAATTCGGGGCTGCTTCAGTCAGACCAGGCTCTTTTGGGTGACAGCACC
ACTGCTTCACTGGTCAACACGTATAGCAAGTGGCCTCTTATGTTCTTCAGAGACTTTGGAATATCTATGGAGAAAATGGGTCGCATAGGTGTACTCACAGGATCACAGGGGCAAATAAGA
ACAAACTGTAGGGCTGTTAACTAG

Retrieve as FASTA