Entry information : GmPrx236 (Glyma13g20170.1)
Entry ID 8995
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx236 (Glyma13g20170.1)
Name (synonym) GmPrx236 (Glyma13g20170.1)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx236
start..stop
S start..stop
GmPrx41 628 0 4..329 3..327
MtPrx56 547 0 27..329 23..325
LjPrx03 540 0 10..329 7..339
CsPrx04 509 0 14..329 14..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23613776..23613854 79 N° 2 23613049..23613197 149 N° 3 23612748..23612936 189 N° 4 23612145..23612310 166
N° 5 23610743..23611149 407  
complement(join(23610743..23611149,23612145..23612310,23612748..23612936,2361304 9..23613197,23613776..23613854))


exon

Literature and cross-references GmPrx236 (Glyma13g20170.1)
DNA ref. Phytozome 12:   Gm13 (23613854..23610743)
Protein sequence: GmPrx236 (Glyma13g20170.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (300)
PWM (Da):   %s   36785.53 (33490.8) Transmb domain:   %s   i12-29o
PI (pH):   %s   6.5 (6.31) Peptide Signal:   %s   cut: 30 range:30-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATTTTQPPSNICFFLLLLLLAHFHLGISQLELNYYSKSCPKAEEIIKEQVTQLYNKHGNTAVSWVRNLFHDCVVKSCDASLLLATVSDVVSEQTSDRSFGMRNFKYVNTIKAAVEKECPFTVSCADIVALSARDAIALLGGPSIEMKTGRKDSKESYAMEVEDLIPNHNDSMSSVLSRFQAIGIDVEATVALLGAHSVGRVHCKNLVHRLYPTIDSTLDPAHAEYLRRRCPTPNPDPKAVLYSRNDLKTPMIIDNNYYKNILQHKGLLTVDEELATDPRTASYVQKMANDNEYFNQQFSRAIILLSETNPLTGDEGEIRKDCRYLNAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns and one extra 5').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCACCACTACCCAGCCTCCCTCTAATATCTGTTTTTTCCTTCTGTTGTTGCTTCTAGCACACTTTCATTTGGGTACGCTAATTATCTAATATTCTACTTACTCTTTCGTTTTT
TCTACGTTCTTTGTAACCTATTACAAAAGACCCTTGTACATATCAGATATAATATAGTATACATCATGAGTTTAATTGCACAATTATTATATATAAAATGACTCTTCAAGTACGTTTAAT
TTACTCAATGATCATGGACATTCCGTATGGATTTGAAGTTGCACTAGTTCTTCTTCAGTAATGGTACATAAACATGTATACATTTAGTTGACTTAATACTTTTTTTTTTTATCATATTAT
ATCACTGTTATATCTATACTTCTCTCTTCTATCTATTTTTTTTTAGTGTATAATAGGACATACATAGGTGTCCAGCTAATGTCCATGTGCACCATTTTCCACTATTCTTCTATGATATAT
AGAGTAATGATATGTTTACATTTTTTATTTCTCTCAATCTTCTTTTTTTTCTTATCATATCATATGTTTTATTATATCTATATATTTTTCTCTTCTTTTCACTATAGGTGTCTAATATCA
CCCCAAGTGTTTATGGATTATTTTCCTAATATATATGATCATGTTGTACATATATAGGCATAAGCCAACTTGAGCTGAATTACTACTCTAAAAGCTGCCCAAAAGCTGAAGAGATCATCA
AGGAACAAGTCACACAACTATATAACAAGCATGGAAACACTGCCGTTTCGTGGGTCAGAAATCTCTTCCACGATTGCGTGGTTAAG
GTGCCAGATTTCTTGTTTCAAATTCATATATAAA
CCAAGATATATGCATCATAATTAGTTAACAACAATGCATGAAACAGTTAAAATAATTGATTTGATGATTCTCATGCAGTCATGCGATGCATCATTACTGTTAGCGACGGTGAGCGATGTA
GTGTCGGAGCAGACATCGGATAGAAGTTTTGGGATGAGAAACTTCAAGTACGTAAACACTATCAAAGCAGCGGTTGAGAAAGAATGCCCCTTCACAGTGTCATGCGCTGACATTGTTGCT
CTTTCTGCCAGAGATGCCATTGCTTTG
GTATGTCTCACTTCTCATCTTGTCTATATATGCACGTCTATAATTATTTCCCTAATTAAATTTCTCACCAAAAATGCCAACAAAATATTTTTA
TTATTCTCATAAAAGAATTAAAAATAAAACATTGTAAAAAATATTATCAATACCCTTTGAGTGACCCTGACCTCGGATCCAAGATTCCCAGTTAAATTTCATAGATGAAAATAAAAGATA
TTTTATTAAAGATGATCTGACAAAAATTAATCATCTATATGGGGATGATGAAAAAATATCATTAATACATTTTGTGATAATTTTTTATTAATTTCTTTTATTTATTAGTTTATTAATTTC
GTGTTGTTAATACCTAAAGGACAAATTAACTAATTTCTTAGAGAAATAATTTGAAAAAATGAGGTTTAATGTGGAGTATGGAATATGGATGTTGGTGCGAGCAGTTGGGAGGACCAAGCA
TTGAAATGAAGACAGGGAGAAAGGACAGCAAAGAAAGCTATGCAATGGAGGTGGAAGACTTGATTCCAAACCACAATGATTCCATGTCCTCAGTGCTGTCTCGTTTTCAAGCCATTGGCA
TTGACGTTGAAGCCACAGTCGCTCTTTTAG
GTATATAAAACATGCTCTGTGTGACACATAAATTTGAAGTCTTTCTCATTATAGTTAACATTTATTTCCCAAAGTCAAAACATAAATCTA
AGTATCTTTTATTACTTAAACGAAACTAATACTCCCTTAAGCAATATATGGACAGATGCCTAACCATTAGGCAGAAACCCAGACACGATATCAATTTGTTGCAGCTGTCAAGATCAAGTT
CATACTAGGCCACTAATATAAAACTTATTCGTATAATTTATACTTTTTTTGCTAATTAAATTAATATACTGCCTTTATTATATAATATATACAGTTTTAATCTCAATAAAAAAAATTAGT
CTATTTGTATGCATCTCAAACGGAATTTGTTGAAAGTGAGAATTTTTTCTCCTTTGAAAAAACTTGTCTCCCTCTAACATGTAAAACTCGTTTACATAATTAAAACAAACAGAACCTTTT
ATCATCTATATAAAAAAAAATTGGGCCAATGAATAAAACATAAATATACTACTGGCTAGCTTTGCATGAGTACTATATTAACAAGACAAATCAATAATGATGCATAAATCACTTTTTATT
TTAAACATTAATCAACACTTTTTTTTAATCTTTCTATTATATCATAAATCTTATTATATTTATATTTTTTTTTCTTTTTTAGTTCTACCAAGGAAATGACAAATCTAGAACCCTAAGTTG
TGGGACAATTTATTTTGAAAATAAAAATTAATAATTAATGTTATGAAAGAAATAAAAAAAATAGGACAAGGGATCAAACACACAAAATTAGAGGGGACAAAATTTACACAATCAATATAT
TGAATAACATATTAGATGTGTATTTGCATTTCTCATTATAATATGAATCTTGTCACAGATGTCTATTAAGTATTTTCTCAACCCAAATAGTATTTATACAACCACTATGCATATATATGT
GATGTGATAGTTAAAAGATAATAAATTTAATTGGTTAAACCGAAACCGTTTGTTGGTTGATTCAGGAGCTCACTCAGTGGGAAGAGTTCACTGCAAGAATCTGGTGCACAGATTATACCC
CACCATAGATTCAACACTGGACCCTGCACATGCTGAGTACCTAAGACGTCGGTGCCCAACACCCAATCCCGATCCAAAAGCTGTTCTGTATTCAAGGAATGACCTTAAAACGCCAATGAT
CATTGACAACAACTACTACAAGAACATCTTGCAACACAAGGGTCTTCTCACTGTGGATGAAGAGCTTGCCACTGACCCAAGAACCGCATCTTATGTCCAAAAGATGGCCAATGACAATGA
ATATTTCAACCAACAGTTCTCAAGGGCCATAATTTTGTTATCGGAGACAAATCCTTTAACAGGAGATGAAGGAGAAATCAGAAAGGATTGTCGCTACCTCAATGCCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCACCACTACCCAGCCTCCCTCTAATATCTGTTTTTTCCTTCTGTTGTTGCTTCTAGCACACTTTCATTTGGGCATAAGCCAACTTGAGCTGAATTACTACTCTAAAAGCTGC
CCAAAAGCTGAAGAGATCATCAAGGAACAAGTCACACAACTATATAACAAGCATGGAAACACTGCCGTTTCGTGGGTCAGAAATCTCTTCCACGATTGCGTGGTTAAG
TCATGCGATGCA
TCATTACTGTTAGCGACGGTGAGCGATGTAGTGTCGGAGCAGACATCGGATAGAAGTTTTGGGATGAGAAACTTCAAGTACGTAAACACTATCAAAGCAGCGGTTGAGAAAGAATGCCCC
TTCACAGTGTCATGCGCTGACATTGTTGCTCTTTCTGCCAGAGATGCCATTGCTTTG
TTGGGAGGACCAAGCATTGAAATGAAGACAGGGAGAAAGGACAGCAAAGAAAGCTATGCAATG
GAGGTGGAAGACTTGATTCCAAACCACAATGATTCCATGTCCTCAGTGCTGTCTCGTTTTCAAGCCATTGGCATTGACGTTGAAGCCACAGTCGCTCTTTTAG
GAGCTCACTCAGTGGGA
AGAGTTCACTGCAAGAATCTGGTGCACAGATTATACCCCACCATAGATTCAACACTGGACCCTGCACATGCTGAGTACCTAAGACGTCGGTGCCCAACACCCAATCCCGATCCAAAAGCT
GTTCTGTATTCAAGGAATGACCTTAAAACGCCAATGATCATTGACAACAACTACTACAAGAACATCTTGCAACACAAGGGTCTTCTCACTGTGGATGAAGAGCTTGCCACTGACCCAAGA
ACCGCATCTTATGTCCAAAAGATGGCCAATGACAATGAATATTTCAACCAACAGTTCTCAAGGGCCATAATTTTGTTATCGGAGACAAATCCTTTAACAGGAGATGAAGGAGAAATCAGA
AAGGATTGTCGCTACCTCAATGCCAATTAG

Retrieve as FASTA