Entry information : GmPrx244 (Glyma14g07730.1)
Entry ID 8998
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx244 (Glyma14g07730.1)
Name (synonym) GmPrx244 (Glyma14g07730.1)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx244
start..stop
S start..stop
GmPrx296 664 0 1..334 1..333
MtPrx45 560 0 1..334 9..347
VvPrx89 518 0 7..334 18..352
NnPrx57 514 0 6..334 15..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5851621..5851854 234 N° 2 5852178..5852369 192 N° 3 5853054..5853219 166 N° 4 5853324..5853736 413
join(5851621..5851854,5852178..5852369,5853054..5853219,5853324..5853736)


exon

Literature and cross-references GmPrx244 (Glyma14g07730.1)
DNA ref. Phytozome 12:   Gm14 (5851621..5853736)
Protein sequence: GmPrx244 (Glyma14g07730.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334
PWM (Da):   %s   36959.7  
PI (pH):   %s   8.48
Sequence 376
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVAFCLSVKLSLANPGFHFGWGGHHHGEISFGLSPQFYQFSCPQANDIVMSVLEKAIAKDMRIAASLLRLHFHDCFVQGCDASILLDDSARIVSEKNSGPNKNSVRGFEVIDKIKSKLEEACPQTVSCADILALAARGSTVLSGGPNWELPLGRRDSKTASLSGSNKNIPPPNATIENLVTFFKRQGLDEVDLVALSGAHTIGVARCATFKQRLYNQKGNNQPDENLEKSFYFDLKTMCPKSGGDNFISPLDFGSPRMFDNTYFKLILRGKGLLNSDEVLLMGNVKETRELVKKYAQDESLFFEQFSMSMIKMGNLRPLIGFNGEVRKNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTAGCTTTTTGCCTCTCAGTGAAACTCTCCCTGGCTAACCCTGGCTTCCATTTTGGCTGGGGTGGTCATCATCATGGGGAAATATCTTTTGGTCTTTCACCTCAATTCTATCAGTTCT
CATGCCCTCAAGCTAATGACATTGTCATGTCAGTGTTGGAGAAGGCCATTGCTAAGGACATGAGAATTGCTGCTTCTCTACTTAGACTTCACTTTCACGATTGCTTTGTGCAG
GTTAATT
AATTAACTACACTTGTCATAAATAAGTAGTCCTACATGAAAATTATTACAATAATAATAATAAACAAAATCAAATTCTTTTAACAAAAACCGTTGAGAAAATTCTTTTTGAAGTTATCTT
TTTTGCCTTGAGCTATTTTTTAGTCTAGATTATTTGCAATTATTAGAGAGTAATGTTACTCATACAATGAAATTTTGTGTAGAAATTGCATATTTTATCTTATGAATAGCATTACTCGTT
ATTAATTTGTTCAGGTTCTTTTGTGTGGATAGGTTGATGGTCTAAATTTTCTTGTTCTTTTTCTTTTGAATGGCAGGGCTGTGATGCATCAATTTTGTTGGATGATAGCGCAAGAATAGT
GAGTGAAAAAAATTCTGGACCTAACAAAAATTCTGTCCGAGGTTTCGAAGTGATTGATAAGATAAAGTCTAAGTTGGAAGAAGCATGTCCTCAAACTGTGTCCTGTGCAGACATTCTTGC
CCTTGCTGCCAGGGGCTCCACCGTTCTT
GTAAGTGCACAATTTTTTTAGTGTAAATATTCATTTTGCATGTATGAGAGAAAGTGATAAATTAATTCCTGAAAATGAAAAATTCAAATTTC
CGATTGTATCAAAACTATGATAGATTACTCTTATGAATAATATAATAATAAATTGATCTCTAAATTTTATAATTTAAAGTTAAATTAATTCTCGAAAAATATAATTTATTATCAAGTGAA
TTCTTAAATATTATAGTTTAATAACAAATTGTTTTGCAAATCTAACAGTAAGATTAATTTGTTACATTTTTTGCACATTCAAAGATTAAATTTAAATTTTTCATTTTTTAATGATCAATT
TATCATCGTCTCACATTTTCAAAGACCAAAATAAATATTTATTCATTTTTTTATTCAAATTGAGATAATCGAGTATGATCCTCTTTGCATGTTACATAATATAGATAGGTAGTTTACCAT
AACATTAGGAGAAATCTTAATAACACTCTTTAATACACTTTGCCTAACATGCTATTTATTATTGACTAATTTTTATAGATAATAGGAAGTGTGGATAATATGTATATGGAAGTTTAGGTT
CAAACCTCATTGCTACGTGTTGTATACACAAAAAAAACATATTATTAGCATTATGCCATTAATGGTTATTAGAAATATGAGATTTTGAAACTTACTTGATTCTTTAAAACAGAGTGGAGG
GCCTAATTGGGAGCTCCCATTAGGGAGAAGAGACTCAAAAACAGCAAGCCTAAGTGGCTCAAACAAAAACATTCCCCCACCAAATGCCACAATTGAAAATCTCGTGACATTTTTCAAGCG
TCAAGGCCTTGATGAAGTGGACCTTGTTGCTCTCTCAG
GTGGAACTTCAACTTCGATCTCATGCCATGCTATGCTTAATGGTATTTATTTCCTAGTAATGAATGAGTTACATATTTTAAC
ATTTTTATTCTACTTAATGTAGGTGCACATACCATTGGGGTGGCAAGATGTGCCACATTCAAGCAGAGACTATACAACCAAAAAGGAAACAACCAACCGGATGAGAATCTAGAAAAGTCC
TTTTACTTTGATTTAAAGACAATGTGCCCAAAATCAGGTGGTGACAACTTCATTTCTCCCTTGGACTTTGGCTCCCCAAGAATGTTTGATAATACCTATTTCAAACTCATACTTAGGGGG
AAAGGACTGCTTAATTCAGATGAAGTGCTTCTTATGGGAAATGTTAAGGAAACTCGTGAATTGGTCAAGAAATATGCACAAGATGAGAGCCTCTTCTTTGAGCAATTTTCCATGTCCATG
ATCAAGATGGGGAACCTCCGTCCTCTCATTGGATTTAATGGAGAAGTTAGGAAAAATTGTCGCCGTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTAGCTTTTTGCCTCTCAGTGAAACTCTCCCTGGCTAACCCTGGCTTCCATTTTGGCTGGGGTGGTCATCATCATGGGGAAATATCTTTTGGTCTTTCACCTCAATTCTATCAGTTCT
CATGCCCTCAAGCTAATGACATTGTCATGTCAGTGTTGGAGAAGGCCATTGCTAAGGACATGAGAATTGCTGCTTCTCTACTTAGACTTCACTTTCACGATTGCTTTGTGCAG
GGCTGTG
ATGCATCAATTTTGTTGGATGATAGCGCAAGAATAGTGAGTGAAAAAAATTCTGGACCTAACAAAAATTCTGTCCGAGGTTTCGAAGTGATTGATAAGATAAAGTCTAAGTTGGAAGAAG
CATGTCCTCAAACTGTGTCCTGTGCAGACATTCTTGCCCTTGCTGCCAGGGGCTCCACCGTTCTT
AGTGGAGGGCCTAATTGGGAGCTCCCATTAGGGAGAAGAGACTCAAAAACAGCAA
GCCTAAGTGGCTCAAACAAAAACATTCCCCCACCAAATGCCACAATTGAAAATCTCGTGACATTTTTCAAGCGTCAAGGCCTTGATGAAGTGGACCTTGTTGCTCTCTCAG
GTGCACATA
CCATTGGGGTGGCAAGATGTGCCACATTCAAGCAGAGACTATACAACCAAAAAGGAAACAACCAACCGGATGAGAATCTAGAAAAGTCCTTTTACTTTGATTTAAAGACAATGTGCCCAA
AATCAGGTGGTGACAACTTCATTTCTCCCTTGGACTTTGGCTCCCCAAGAATGTTTGATAATACCTATTTCAAACTCATACTTAGGGGGAAAGGACTGCTTAATTCAGATGAAGTGCTTC
TTATGGGAAATGTTAAGGAAACTCGTGAATTGGTCAAGAAATATGCACAAGATGAGAGCCTCTTCTTTGAGCAATTTTCCATGTCCATGATCAAGATGGGGAACCTCCGTCCTCTCATTG
GATTTAATGGAGAAGTTAGGAAAAATTGTCGCCGTGTTAATTAA

Retrieve as FASTA