Entry information : GmPrx253 (Glyma14g40150.1)
Entry ID 9001
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx253 (Glyma14g40150.1)
Name (synonym) GmPrx253 (Glyma14g40150.1)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx253
start..stop
S start..stop
MtPrx55 538 0 2..316 3..318
MePrx114 519 0 14..315 19..319
CsPrx27 514 0 2..315 3..316
CpapPrx26 513 0 9..316 16..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49129445..49129645 201 N° 2 49129838..49130026 189 N° 3 49130506..49130668 163 N° 4 49131045..49131442 398
join(49129445..49129645,49129838..49130026,49130506..49130668,49131045..49131442 )


exon

Literature and cross-references GmPrx253 (Glyma14g40150.1)
DNA ref. Phytozome 12:   Gm14 (49129445..49131442)
Protein sequence: GmPrx253 (Glyma14g40150.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (296)
PWM (Da):   %s   34148.5 (31987.3)  
PI (pH):   %s   8.91 (8.91) Peptide Signal:   %s   cut: 21 range:21-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATIATVMLITMSLASLVSALNVNYYENACPHNVDSIVAAAVHKATMNDKTVPAALLRMHFHDCFIRGCDASVLLESKGKKKAEKDGPPNISLHAFYVIDNAKKAVEAVCPGVVSCADILALAARDAVALSGGPTWDVPKGRKDGRISKATETRQLPAPTFNISQLQQSFSQRGLSLEDLVALSGGHTLGFAHCSSFQNRIHKFSQKLEIDPSLNPSFARSLRGICPSHNKVKNAGSSLDSSSTLFDNAYYKLLLQGKSLFSSDQALLTHPTTKALVSNFADSQEEFERAFVKSMIKMSSITNGGQEIRLNCKLVR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACTATTGCTACAGTTATGCTTATAACTATGTCCCTGGCTTCTCTTGTGAGTGCACTAAATGTAAATTACTATGAAAATGCGTGCCCCCATAATGTAGATTCCATTGTAGCTGCT
GCTGTTCACAAAGCAACCATGAATGACAAAACTGTCCCAGCTGCTCTTCTTCGGATGCATTTTCATGATTGCTTCATAAGG
GTATGCAACTTTTTGCTTGTCCTAATTCAAATAATATTC
ATATGGGGCAAGTAACATGCCTTTGCGTGTTAGTTCAATTTATTTTGAAAAAGTAATCCTCTTCAAAACATGTGCATGCACTAACATTGTAGTAGTTAGAGTGGATACGTATAAAACTGA
TCATATATTTACTCTTTTTTTTTTTTTTTGAAGGGTTGTGATGCCTCTGTTCTTCTCGAATCAAAAGGTAAGAAAAAAGCAGAAAAGGATGGACCTCCTAACATTTCTTTACATGCATTC
TATGTCATTGACAACGCTAAGAAAGCAGTGGAAGCCGTTTGCCCCGGGGTAGTATCTTGTGCTGATATTTTGGCTCTTGCTGCTAGGGATGCTGTTGCTCTG
GTCAGTGTCTCAAGCAAT
AGCATATAATATACTTACATAGTAATCATAGTTTTTATTTTAATTATTAATTTGAGATTATTTTTTTGTCAATCTCACTAAAACAAAACCATTTAGAGTACTCTTAGATAAAATGAAGGT
TAAATTATGTTTTCCATTCTGATAAAACAATAATTTTATTTTTATTCTTGACCTTTTTTTTAATTTATGGTAAATTAATAAATTTTATATTTTTATTAGTCTTTTATAAAACAACTAATA
ACATTGAAATTTTTTATAGAGAAAAACATAAAATTCACTAATTATTATAGACTAAAAAAATATCAAAAATAAAAAATAAATTTTTATTTTATCAGAAAGTAGAAATGAAGAAAAAAATAT
TTAAAAATAAATATAAAATTTAAATATTTATTAGGAATCACACGTATTTTAACAAATAAATATTAGAAATTTATTTACTTACTGCCTTTGTGTGGATTTAGTCGGGAGGACCCACTTGGG
ATGTGCCAAAAGGAAGAAAGGATGGAAGGATATCAAAGGCCACAGAAACCAGACAATTGCCGGCTCCCACCTTCAACATCTCCCAATTACAACAAAGCTTCTCCCAAAGAGGCCTTTCCT
TGGAAGATCTTGTAGCCCTCTCAG
GTACTATTGAAAATCTTAAATTATGAATTCAATTGCAAGAGATCTAATACTGAGAAGGAACATGTTAAGTTCTTCCTTTACAGCCACTTATCATGA
TTTCATATTTGTTTAATCAATTCCTAACATCCTATTTCTTAACCAGAAATAAACTTTGCTTTAGTAAAATAACCATTACACATAAATATTTTAATATACATATATGGTTCCTAACATTCC
TAGAACCAGTGTAAAAAAAATCAATGTCTTAACCGCATTGGATTGGATGGTAGGAGCCTTATTATAAATGTAACTTGTCATATATGATAACATGTATTGGATAACAGAAGATCGACCATG
CATTCTAATTAAACTCTTATACAAATGATGTTATGTTCAGGAGGTCACACCCTGGGGTTTGCTCATTGTTCATCTTTCCAAAACAGAATCCATAAGTTCAGCCAGAAACTAGAGATTGAC
CCATCTCTGAACCCTTCATTCGCAAGAAGCCTCCGAGGCATATGCCCCTCTCACAACAAGGTTAAAAATGCAGGAAGCTCATTGGATTCTAGTTCCACCTTGTTTGACAATGCTTATTAC
AAGCTACTCCTCCAAGGAAAGAGCTTATTCTCCTCTGATCAAGCTCTGCTCACTCATCCCACCACTAAAGCTTTGGTTTCCAACTTTGCTGATTCGCAAGAGGAATTTGAAAGGGCCTTC
GTCAAGTCCATGATCAAGATGAGCAGCATCACCAACGGTGGACAAGAAATCAGGCTCAATTGTAAACTCGTTAGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACTATTGCTACAGTTATGCTTATAACTATGTCCCTGGCTTCTCTTGTGAGTGCACTAAATGTAAATTACTATGAAAATGCGTGCCCCCATAATGTAGATTCCATTGTAGCTGCT
GCTGTTCACAAAGCAACCATGAATGACAAAACTGTCCCAGCTGCTCTTCTTCGGATGCATTTTCATGATTGCTTCATAAGG
GGTTGTGATGCCTCTGTTCTTCTCGAATCAAAAGGTAAG
AAAAAAGCAGAAAAGGATGGACCTCCTAACATTTCTTTACATGCATTCTATGTCATTGACAACGCTAAGAAAGCAGTGGAAGCCGTTTGCCCCGGGGTAGTATCTTGTGCTGATATTTTG
GCTCTTGCTGCTAGGGATGCTGTTGCTCTG
TCGGGAGGACCCACTTGGGATGTGCCAAAAGGAAGAAAGGATGGAAGGATATCAAAGGCCACAGAAACCAGACAATTGCCGGCTCCCACC
TTCAACATCTCCCAATTACAACAAAGCTTCTCCCAAAGAGGCCTTTCCTTGGAAGATCTTGTAGCCCTCTCAG
GAGGTCACACCCTGGGGTTTGCTCATTGTTCATCTTTCCAAAACAGA
ATCCATAAGTTCAGCCAGAAACTAGAGATTGACCCATCTCTGAACCCTTCATTCGCAAGAAGCCTCCGAGGCATATGCCCCTCTCACAACAAGGTTAAAAATGCAGGAAGCTCATTGGAT
TCTAGTTCCACCTTGTTTGACAATGCTTATTACAAGCTACTCCTCCAAGGAAAGAGCTTATTCTCCTCTGATCAAGCTCTGCTCACTCATCCCACCACTAAAGCTTTGGTTTCCAACTTT
GCTGATTCGCAAGAGGAATTTGAAAGGGCCTTCGTCAAGTCCATGATCAAGATGAGCAGCATCACCAACGGTGGACAAGAAATCAGGCTCAATTGTAAACTCGTTAGATGA

Retrieve as FASTA