Entry information : GmPrx282 (Glyma16g33250.1)
Entry ID 9012
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-31 (Achraf Jemmat)
Peroxidase information: GmPrx282 (Glyma16g33250.1)
Name (synonym) GmPrx282 (Glyma16g33250.1)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx282
start..stop
S start..stop
GmPrx65 605 0 1..310 15..328
LjPrx25 561 0 1..310 1..313
GmPrx14 515 0 1..310 1..314
GrPrx39 509 0 1..310 11..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36225730..36225942 213 N° 2 36226813..36227001 189 N° 3 36227483..36227645 163 N° 4 36228887..36229254 368
join(36225730..36225942,36226813..36227001,36227483..36227645,36228887..36229254 )


exon

Literature and cross-references GmPrx282 (Glyma16g33250.1)
DNA ref. Phytozome 12:   Gm16 (36225730..36229254)
Protein sequence: GmPrx282 (Glyma16g33250.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   311 (292)
PWM (Da):   %s   33862.52 (31734.5)  
PI (pH):   %s   4.88 (4.99) Peptide Signal:   %s   cut: 19 range:19-310
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANLLTMFFVMEMIVVSGFSFGASGLSMNYYLLSCPIAEPVVKNTVNTALQDDPTLAAGLVRMHFHDCFIEGCDGSVLIDSTKDNTAEKDSPANLSLRGYEVIDDIKEELEKQCPGVVSCADIVAMAARDAVFFAGGPVYDIPKGRKDGTRSKIEDTINLPAPIFNASELIKMFGQRGFSTRDMVALSGAHTLGVARCSSFKNRLTQVDSEFAKTLSKTCSAGDTAEQPFDSTRSDFDNQYFNALVSNNGVLTSDQTLYNSPQTRNIVNAYAMNQALFFLDFQQAMVKMSMLDAKQGSKGEVRKNCHQIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAATTTGCTGACAATGTTTTTTGTTATGGAAATGATAGTAGTGAGTGGTTTCAGTTTTGGAGCAAGTGGCTTGAGCATGAATTACTACTTGTTGAGTTGCCCTATTGCTGAACCT
GTTGTTAAGAACACTGTCAACACAGCTCTGCAGGATGATCCCACCCTAGCAGCAGGTCTTGTTAGAATGCACTTCCATGACTGTTTCATAGAG
GTTCATTCTCTCTCTCTCTCTCTTAAT
TATACAAACAATATCTCACTCACACTTGCCAGAAATTATTACATGGTCCAAAAGTATCATAATCTCAGACAATCTTTGTGTGATACGTAACTGAGTTTTATTAAATCTTTTATATAAAAT
GTAAAACTTGATTAAGTGTGGTAAGTGGAGATTAGTTGGAACTATATAGACATATAATGGTCTTCATTCTGAAACATGTAATAAATTTCTCCATACTTTTACACAGATATGGATGAAAAA
GCATGGTGAAAAAATGTTAGAGGTTTAATATAAAAATTAACATTTGTATCGTCATGCTGATAAAAAAAATAGTTTGTGTCTTCGCCTAGTTTAAATTAACTTATGAAATGTTGATTCATG
ACACAATATTAGAGTCTATGCGACTTAGTGATCTTTAAGTTGATCCTTATCTACTCCATTTTCCTAATAAAAAATTGAATTTCTTTAGCATAGGGAAGTGGATGGGCTCGTGTATTGTCT
ATACTTCAAGTTAGAAGTGCATGTTAAAGATGTAATATAAATCATTCACGTGTTTCTATATACAAGGTTTTAATAAATGTTAATATTGTTGCTTCATGACAAAGAAAAAAGGAGTGGAGA
GAAATATGATTGAAGTAAACATACAAAAACCTAAGATACTTAAATAAGCACACATGTAGAAAAGGCAGACATGACTGTATTTACGTAACTTTGAAGATGCCATGTCTGTCTTTCAAGGGC
AAACTTACTAACTTGCATCCATTTTCTAAACTTATAAACTGCACATTATTAACTTATAAGTATTATTTCACGAGTATGATCATATATGTGTGGTGATACAAAGGGTTTATTTTTGTCTAC
TAGGGATGTGATGGTTCAGTTCTGATTGACTCCACTAAGGACAACACAGCAGAAAAGGATTCACCAGCAAACTTGAGCTTGAGAGGCTATGAAGTCATAGATGACATCAAGGAAGAGCTT
GAAAAACAATGCCCGGGAGTGGTTTCATGCGCTGATATTGTCGCTATGGCTGCTAGAGATGCAGTTTTCTTT
GTAAGATGAAGCTACTACAAATTTATTGTTGTGTACCTTATTTTCAAA
TTTTTTTGGTGTCACAAAGGTGAATTCAATTTCAATACACAATTAATGAATTAGAAATGGCCTTGTATATAACTTTTGTAGAAACTATGACAAAAGTTAACATACCATTAAAGTTTAATA
TAGTTGGTAGATGATTGGATTCTTTAAACATGTTAACATAAGTTTAATTTGTTGGTCGTGCTTATAAAAAAGATTTTGTTGGAAGACAAAAAACATACTTAATTATTTTTATATCTCGAG
GATTAGTCTCGTTGACTTTCGACTATAGAGATATCTTTCTTTAAAAAAAAACAAATAATAAAAGTTAAAAAATTTATCATTCATAACAATTTATGATTGAATAATAGTATAAAATACTTT
TTGGAACTAATTAAATTCTTAAATAATTGCAATTAACTTTACCTAATGTCATTATTACCTATGACATGTGCAGGCAGGGGGTCCTGTATATGACATACCAAAAGGAAGGAAGGATGGAAC
AAGGTCCAAAATTGAGGATACTATCAATCTACCTGCACCCATTTTCAATGCTTCTGAGCTCATCAAGATGTTCGGACAACGTGGGTTTTCTACAAGAGACATGGTGGCTCTATCAG
GTAA
TATAATATGTCTCTGTTTTTGCTATTTTTATTATGTGTCAAATAAGTCAAAGAGAATTAACTCTGACATAACCATACATACCATGTGTTAAATAGTAAATTCTGAAATGTTTCCAAATTA
GTACGCACTAATTGAAGTTTTAGAACATGGTTAATTGTTTGGTTGATGCACAGATGAAAAAGACAATCATAAATGGGTGGATGGGAAAAAAATTGTAGTGTAGTATATAAGAAATAAATC
AAAGAAATTGATTAATTCATTCACTCTGCAGGTTAACTTTGATAGGACTTCATACTTAGGATTATCCCAATTAATTGTGAATATTCTCCCTACTCGTTTTTTTCGAGGATCAAACTTGCT
GATATTGTTAATAAACAGAAATAACTTAGTTTACATCAAGAGAAATGATTTGGTCCAATTGAATTGGGATCTCCTCTAACCAGCAATGGTCCAAATAAGGAAAAAGCTAGAGATGCTAAG
CAATCTGCAACTTTATTTCCCTGCCTCTTAGTGAAGGTAAGGTTCTGAAGCAGATGATTTGGCAAGATATGCCTGAAATCATGCATTAATCCATGGAATAAATCTTACTAATAAAAACTA
ACCATTTAACAATTCACATTTATTGACAAAAATTCATGAAATAAATCCTTCCCATTATTAATTTGTTACTAAAATTTAGTGAACTTAATTAGCTGGCAAGAGAAAAGTAATTTTGCATGA
GTATGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTTATTACTCCCTTCTCCTTCAAGGAAAAAAAAATACTGATTCAATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAA
TGGAATGAATAGTAAATAGAGATTTTGATTTGTGCAGGAGCTCACACATTAGGAGTGGCAAGGTGTTCTTCATTCAAGAACAGACTGACCCAAGTGGACTCAGAATTTGCGAAGACACTC
TCCAAGACATGCAGTGCGGGTGACACTGCTGAGCAACCCTTTGACTCCACGAGGAGCGATTTTGACAACCAATACTTCAACGCTTTGGTCTCAAACAACGGGGTTCTCACATCGGACCAA
ACGTTGTACAACAGCCCACAAACCAGGAACATTGTGAACGCTTATGCAATGAATCAAGCCTTGTTTTTCTTGGATTTCCAACAGGCAATGGTGAAGATGAGCATGCTCGATGCCAAACAA
GGGTCCAAGGGGGAAGTACGAAAAAATTGTCATCAAATAAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAATTTGCTGACAATGTTTTTTGTTATGGAAATGATAGTAGTGAGTGGTTTCAGTTTTGGAGCAAGTGGCTTGAGCATGAATTACTACTTGTTGAGTTGCCCTATTGCTGAACCT
GTTGTTAAGAACACTGTCAACACAGCTCTGCAGGATGATCCCACCCTAGCAGCAGGTCTTGTTAGAATGCACTTCCATGACTGTTTCATAGAG
GGATGTGATGGTTCAGTTCTGATTGAC
TCCACTAAGGACAACACAGCAGAAAAGGATTCACCAGCAAACTTGAGCTTGAGAGGCTATGAAGTCATAGATGACATCAAGGAAGAGCTTGAAAAACAATGCCCGGGAGTGGTTTCATGC
GCTGATATTGTCGCTATGGCTGCTAGAGATGCAGTTTTCTTT
GCAGGGGGTCCTGTATATGACATACCAAAAGGAAGGAAGGATGGAACAAGGTCCAAAATTGAGGATACTATCAATCTA
CCTGCACCCATTTTCAATGCTTCTGAGCTCATCAAGATGTTCGGACAACGTGGGTTTTCTACAAGAGACATGGTGGCTCTATCAG
GAGCTCACACATTAGGAGTGGCAAGGTGTTCTTCA
TTCAAGAACAGACTGACCCAAGTGGACTCAGAATTTGCGAAGACACTCTCCAAGACATGCAGTGCGGGTGACACTGCTGAGCAACCCTTTGACTCCACGAGGAGCGATTTTGACAACCAA
TACTTCAACGCTTTGGTCTCAAACAACGGGGTTCTCACATCGGACCAAACGTTGTACAACAGCCCACAAACCAGGAACATTGTGAACGCTTATGCAATGAATCAAGCCTTGTTTTTCTTG
GATTTCCAACAGGCAATGGTGAAGATGAGCATGCTCGATGCCAAACAAGGGTCCAAGGGGGAAGTACGAAAAAATTGTCATCAAATAAATTAA

Retrieve as FASTA