Entry information : GmPrx296 (Glyma17g37240.1)
Entry ID 9019
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx296 (Glyma17g37240.1)
Name (synonym) GmPrx296 (Glyma17g37240.1)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx296
start..stop
S start..stop
GmPrx244 634 0 1..333 1..334
MtPrx45 564 0 1..333 9..347
VvPrx89 525 0 1..333 12..352
CpapPrx09 521 0 5..333 19..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 41036056..41036286 231 N° 2 41035382..41035573 192 N° 3 41034850..41035015 166 N° 4 41034358..41034770 413
complement(join(41034358..41034770,41034850..41035015,41035382..41035573,4103605 6..41036286))


exon

Literature and cross-references GmPrx296 (Glyma17g37240.1)
DNA ref. Phytozome 12:   Gm17 (41036286..41034358)
Protein sequence: GmPrx296 (Glyma17g37240.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (320)
PWM (Da):   %s   37060.82 (35526.0)  
PI (pH):   %s   8.57 (8.40) Peptide Signal:   %s   cut: 14 range:14-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIAFFLSVKLSLAHPGFHFGWGDHHRGISFGLSPQFYQFSCPQANDIVMSVLEKAIAKDMRIAASLLRLHFHDCFVQGCDASILLEDSARIVSEKNSGPNKNSVRGFEVIDKIKSKLEEACPQTVSCADILALAARGSTVLSGGPNWELPLGRRDSKTASLSDSNKNIPPPNATIENLVTFFKRQGLDEVDLVALSGAHTIGVARCVTFKQRLYNQKGNNQPDENLEKSFYFDLKTMCPKSGGDNFISPLDFGSPRMFDNTYFKLILRGKGLLNSDEVLLMGNVKETRELVKKYAQDESLFFEQFAMSMIKMGNLRPLTGFNGEVRKNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAGCTTTTTTCCTCTCAGTGAAACTCTCCCTGGCTCACCCTGGCTTCCATTTTGGTTGGGGTGATCATCATAGGGGAATATCTTTTGGTCTTTCACCTCAATTCTATCAATTTTCA
TGCCCTCAAGCTAATGACATTGTCATGTCTGTGTTGGAGAAGGCCATTGCAAAGGACATGAGAATTGCTGCTTCTCTACTTAGACTTCACTTTCACGATTGCTTTGTGCAG
GTGAATTAA
TTAATTACACTTGTCATAAGAAGTCCTACATGAAAACTATTAAAAGAATAATATTAATCCCAATCCTATTTATAAGAAACCAATTATAGTGTATTTTATGAAGTAATAGTGTAAACAAAA
TCAAATTCTTTAACAAAACCCGTTGAGAAAATTCTTTTTGGGGGTTATCTTTGTTGCCTTGAGATATTTTTTAGTCTAAATTATTTGCAATTATTAGAGAGTAATGTTACTTATACAATA
AAATTGTGTGGAAATCCACTTTATCTTAAAATGGGCTGATCGGATCAGAAATGATTAGTTGGATGTGAAATAAGAAACTTGGTATACCTCTAGTTGAACAAAAAATAATTTTTTTTTGTA
GAAATTGTTTATTTTATGAATAATATTACTCGTCGTTAACTTGTTTCAGGTTCTTTTGTATGAATACGATGATGGTCTAAATTTTCTTGTTTTTTTTTTCTTTTGAATGGCAGGGCTGTG
ATGCATCAATTTTGTTGGAAGATAGCGCAAGAATAGTGAGTGAAAAAAATTCTGGACCTAACAAAAATTCTGTCCGAGGCTTCGAAGTGATTGATAAGATAAAGTCTAAGTTGGAAGAAG
CATGTCCTCAGACTGTGTCCTGTGCAGACATTCTTGCCCTTGCTGCCAGGGGCTCCACTGTTCTT
GTAAGTGAACAAGCTTCACTCATATTGAACAACCCTAGTATCCAAAGACTTTGCA
TGTCACAGAAGGCAGTTTAACCCATGACATGATGACAAATCTTAATAAAACAATCTTTTTAATTCATTTTATCAAATACATTCTTTATTATTGACCAAATTTTATTGAGATAATTATATA
AGAAGTGAAATTTATGTTATTTCATAAATCTTTAATAAATTTCAACCGATAACAAAAAAGTTTTAAAGAGTGTGTTTTAGAACCTATTATTAGCATTTAACTTTATTGTTGTCGGTGCTG
TATACACAAAAAAATAGAGAGAACATTAGAAATATGTAAGATTTTGAAAGTTATTTGATTCTTTAAAACAGAGTGGAGGACCTAATTGGGAACTCCCATTAGGGAGAAGAGACTCAAAAA
CAGCAAGCTTAAGTGACTCAAACAAAAACATTCCCCCACCAAATGCCACCATTGAAAATCTTGTGACATTTTTCAAGCGTCAAGGCCTTGATGAAGTGGACCTCGTTGCCCTCTCAG
GTG
GAACTTCAACTTCTCATTTTATTTCCTAGTAATGAATGAGTCACATATATTAACATTTTTATTAATTATAATGTAGGTGCACATACCATTGGGGTGGCAAGATGTGTCACATTCAAGCAG
AGACTATACAACCAAAAAGGAAACAACCAACCGGATGAGAATCTAGAAAAATCCTTTTACTTTGATTTGAAGACGATGTGCCCAAAATCAGGTGGTGACAACTTCATTTCTCCCTTGGAC
TTTGGCTCCCCAAGAATGTTTGATAATACCTATTTCAAACTCATACTTCGGGGTAAAGGACTGCTTAATTCAGATGAAGTGCTTCTTATGGGAAATGTTAAGGAAACTCGGGAATTGGTC
AAGAAATATGCACAAGATGAGAGCCTTTTTTTTGAGCAATTTGCCATGTCCATGATCAAGATGGGGAACCTTCGTCCTCTTACTGGATTTAATGGAGAAGTTAGGAAGAATTGTCGCCGT
GTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAGCTTTTTTCCTCTCAGTGAAACTCTCCCTGGCTCACCCTGGCTTCCATTTTGGTTGGGGTGATCATCATAGGGGAATATCTTTTGGTCTTTCACCTCAATTCTATCAATTTTCA
TGCCCTCAAGCTAATGACATTGTCATGTCTGTGTTGGAGAAGGCCATTGCAAAGGACATGAGAATTGCTGCTTCTCTACTTAGACTTCACTTTCACGATTGCTTTGTGCAG
GGCTGTGAT
GCATCAATTTTGTTGGAAGATAGCGCAAGAATAGTGAGTGAAAAAAATTCTGGACCTAACAAAAATTCTGTCCGAGGCTTCGAAGTGATTGATAAGATAAAGTCTAAGTTGGAAGAAGCA
TGTCCTCAGACTGTGTCCTGTGCAGACATTCTTGCCCTTGCTGCCAGGGGCTCCACTGTTCTT
AGTGGAGGACCTAATTGGGAACTCCCATTAGGGAGAAGAGACTCAAAAACAGCAAGC
TTAAGTGACTCAAACAAAAACATTCCCCCACCAAATGCCACCATTGAAAATCTTGTGACATTTTTCAAGCGTCAAGGCCTTGATGAAGTGGACCTCGTTGCCCTCTCAG
GTGCACATACC
ATTGGGGTGGCAAGATGTGTCACATTCAAGCAGAGACTATACAACCAAAAAGGAAACAACCAACCGGATGAGAATCTAGAAAAATCCTTTTACTTTGATTTGAAGACGATGTGCCCAAAA
TCAGGTGGTGACAACTTCATTTCTCCCTTGGACTTTGGCTCCCCAAGAATGTTTGATAATACCTATTTCAAACTCATACTTCGGGGTAAAGGACTGCTTAATTCAGATGAAGTGCTTCTT
ATGGGAAATGTTAAGGAAACTCGGGAATTGGTCAAGAAATATGCACAAGATGAGAGCCTTTTTTTTGAGCAATTTGCCATGTCCATGATCAAGATGGGGAACCTTCGTCCTCTTACTGGA
TTTAATGGAGAAGTTAGGAAGAATTGTCGCCGTGTTAATTAA

Retrieve as FASTA