Entry information : GmPrx[P]297 (Glyma17g37980.1)
Entry ID 9020
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: GmPrx[P]297 (Glyma17g37980.1)
Name (synonym) GmPrx[P]297 (Glyma17g37980.1)
Class Class III peroxidase     [Orthogroup: Prx016]*
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx[P]297
start..stop
S start..stop
GmPrx253 347 2e-122 1..186 1..185
MtPrx55 308 8e-107 7..186 9..187
CsPrx27 287 1e-98 1..186 1..186
PtPrx65 287 2e-98 1..186 1..187
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 41716621..41716857 237 N° 2 41716271..41716426 156 N° 3 41715886..41716095 210  
complement(join(41715886..41716095,41716271..41716426,41716621..41716857))


exon

Literature and cross-references GmPrx[P]297 (Glyma17g37980.1)
DNA ref. Phytozome 12:   Gm17 (41716857..41715886)
Protein sequence: GmPrx[P]297 (Glyma17g37980.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   200 (179)
PWM (Da):   %s   21639.37 (19551.2) Transmb domain:   %s   o4-26i
PI (pH):   %s   8.96 (8.96) Peptide Signal:   %s   cut: 22 range:22-200
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAIATVIMLITMSLASLVSALNVNYYENTCPHNVDSIVAAAVHKATMNDRTVPAALLRMHFHDCFIRVCNFLLVLNSKGKNKAEKDGPPNISLHAFYVIDNAKKAVEAVFPGIVSCADILALAARDAVALSGGPTWDVTKGRKDGRISKATETRQLPAPTFNISQLQQSFFQRGLSLEDLVALSGTIENFKLRIQLQKI*

Retrieve as FASTA  
Remarks Pseudogene from genomic. Incorrect prediction from Phytozome (No ATG and no exon 4).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTATTGCTACAGTTATTATGCTCATAACTATGTCCCTGGCTTCTCTTGTGAGTGCACTAAATGTAAATTACTATGAAAATACGTGCCCCCATAATGTAGATTCCATTGTAGCT
GCTGCTGTTCACAAAGCAACCATGAATGACAGAACTGTCCCAGCTGCTCTCCTTCGGATGCATTTTCATGATTGCTTCATAAGGGTATGCAACTTTTTGCTTGTCCTAAATTCAAAA
AAT
ATTCATATGGGGCAATGCAAGTAACATGCCTTTGCGTGTTAGTTCAATTTATTTTGAAAAACTAATCCTCTTCAAAACATGCATGCACTAACATCGTAGTAGTTAAAGTGGATACGTATA
AAACTGATCATATATTTACTCTTTAATTTTTATGTAAGGGTTGTGATGCCTCTGTACTTCTGGAATCAAAAGGTAAGAATAAAGCAGAAAAGGATGGACCTCCTAACATTTCTTTGCATG
CATTCTATGTCATTGACAATGCTAAGAAAGCAGTGGAAGCCGTTTTCCCCGGGATCGTATCTTGTGCTGATATTTTGGCTCTTGCTGCTAGGGATGCTGTTGCCCTT
GTTAGTGTCTCAA
ACAATTGCATATAATTTAATATAATTATATAGTAATCATAATTGTATTTAATTATTATTTTGAGATACTTTTTTGTCAATCCCTCTGCAACAAAACCATTTAGAATCTTAGATAAAATTA
ATATTAGAAATTTATTTACTTATTGCCTTTGTGTGGATTTAGTCCGGAGGACCCACTTGGGATGTGACAAAAGGAAGAAAGGATGGAAGAATATCAAAGGCCACTGAAACCAGACAACTG
CCGGCTCCCACCTTCAACATCTCCCAATTACAACAAAGCTTCTTCCAAAGAGGCCTTTCCTTGGAAGATCTTGTGGCCCTCTCAGGTACTATTGAAAATTTTAAATTACGAATTCAATTG
CAAAAGATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTATTGCTACAGTTATTATGCTCATAACTATGTCCCTGGCTTCTCTTGTGAGTGCACTAAATGTAAATTACTATGAAAATACGTGCCCCCATAATGTAGATTCCATTGTAGCT
GCTGCTGTTCACAAAGCAACCATGAATGACAGAACTGTCCCAGCTGCTCTCCTTCGGATGCATTTTCATGATTGCTTCATAAGGGTATGCAACTTTTTGCTTGTCCTAAATTCAAAA
GGT
AAGAATAAAGCAGAAAAGGATGGACCTCCTAACATTTCTTTGCATGCATTCTATGTCATTGACAATGCTAAGAAAGCAGTGGAAGCCGTTTTCCCCGGGATCGTATCTTGTGCTGATATT
TTGGCTCTTGCTGCTAGGGATGCTGTTGCCCTT
TCCGGAGGACCCACTTGGGATGTGACAAAAGGAAGAAAGGATGGAAGAATATCAAAGGCCACTGAAACCAGACAACTGCCGGCTCCC
ACCTTCAACATCTCCCAATTACAACAAAGCTTCTTCCAAAGAGGCCTTTCCTTGGAAGATCTTGTGGCCCTCTCAGGTACTATTGAAAATTTTAAATTACGAATTCAATTGCAAAAGATC
TAA

Retrieve as FASTA