Entry information : GmPrx310 (Glyma19g33080.1)
Entry ID 9024
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-09 (Christophe Dunand)
Peroxidase information: GmPrx310 (Glyma19g33080.1)
Name (synonym) GmPrx310 (Glyma19g33080.1)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx310
start..stop
S start..stop
GmPrx136 635 0 1..331 1..330
MtPrx23 580 0 6..331 51..373
GmPrx38 555 0 1..331 2..331
GmPrx71 551 0 1..331 2..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 40721578..40721793 216 N° 2 40721927..40722121 195 N° 3 40722249..40722414 166 N° 4 40723223..40723641 419
join(40721578..40721793,40721927..40722121,40722249..40722414,40723223..40723641 )


exon

Literature and cross-references GmPrx310 (Glyma19g33080.1)
DNA ref. Phytozome 12:   Gm19 (40721578..40723641)
Protein sequence: GmPrx310 (Glyma19g33080.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (306)
PWM (Da):   %s   34962.16 (32043.7)  
PI (pH):   %s   5.2 (4.93) Peptide Signal:   %s   cut: 26 range:26-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSFTYSLFTTIFLVLTIFLHPSNAQLSSTFYSSTCPNVSSVVRSVVQQALQSDPRIAASLTRLHFHDCFVNGCDGSILLDVGGNITLSEKNAGPNNNSARGFDVVDNIKTSVENSCPGVVSCADILALAAEASVSLGGGPSWNVQLGRRDGLIANQSGANTSIPNPTESLANVTAKFAAVGLNVTDLVALSGAHTFGRAQCRFFNQRLFNLSGTGSPDPTLNATYLATLQQNCPQNGSGNTLNNLDPSSPDTFDNNYFQNLLSNQGLLQTDQELFSTNGAATISVINNFAANQTAFFQAFAQSMINMGNISPLTGSRGEIRSDCKRVNGS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTTTTACTTATTCCCTATTCACCACCATTTTCTTAGTGCTAACAATCTTTCTTCATCCATCAAATGCTCAACTGAGTTCAACCTTCTACTCCAGCACGTGCCCCAACGTGTCT
TCCGTTGTGCGCAGTGTTGTTCAGCAGGCTCTGCAATCTGATCCTCGTATTGCTGCGAGCCTAACTCGTCTTCATTTTCATGATTGCTTTGTTAAT
GTAAATCCCATGTACACAATCATT
TAATTTTAAACTCCCAACAAATTTTCAAGAAGAGCATGAATTTATGTAACTGATCTAATTCATTTTTATTCTGCTCCCATAGTTAATAAATATTTTCCTTTTTTTTAAGGGATGCGATGG
ATCCATTTTGTTAGACGTAGGTGGCAACATAACACTGAGCGAGAAAAATGCAGGTCCCAACAACAATTCAGCTCGTGGCTTTGATGTAGTGGACAACATAAAGACATCTGTTGAAAATTC
ATGCCCTGGTGTTGTATCTTGTGCTGATATTCTTGCCCTTGCTGCTGAAGCTTCTGTGTCTTTG
GTAACTTGTTATTAATTAATAGTTGATGATTCTCCTTTTCTTATCAAATTTATATA
GCACAAAAAAGGATGTAGAGGTATTTACTTTAGAGGGCATAACATAACTGCATATTATATATTATTTGCAGGGAGGAGGTCCTTCATGGAACGTACAACTAGGAAGAAGGGACGGTTTGA
TTGCAAACCAATCTGGTGCCAACACATCCATTCCCAATCCAACTGAAAGCCTGGCCAATGTCACAGCCAAGTTTGCTGCAGTTGGCTTAAACGTAACTGATCTCGTTGCATTATCTG
GTA
ATCATAATACTTCCCCCGGATAGCTATAGTTTCCTGTGTACACACACAAACTTCATGAGAGTCACTGAATCACTGATAATAAAAAAAAACATTAAGAGCATGTGCATGTAGATAAATAGC
TTAAACAAATACTACTAATTAACTTAATAAGAACTTATCCAACAAAAATGTCACTTTAATCATATTCCAACTGTTAAAATCCATTTCATATCTTAAAATGATTTTTCAACTTAGGTATAA
TCTAAATTATTAAAAAAAGTAAATATTGTAGGATAAATTTAGTGCAATGTTATTTCAGATGTTACCTATCCACCTTATTATTGTCAACAAAAAAAAGGAAAATATTTTTATATCCATAAA
ATTGTAAAAAAAATATATCAAAAAAATTAATAACAACGCATTTTATTTAATTAAATTCAGTTAGATTCCTTCAAAATAAAAAAAATACTAACCATAGCATCTAAATACACTAGCTAATAA
ATCAAAACTCAAATATTTTTGTTGAAAAGTGTAACACTACATTATCTCAAGCTAAAAAAATTATTTATTGGTTTCTTTAACCATTGTGATAGTGAATAGCAAGAGTACTCTTAAATATTA
AAATGAATTGTATATGCTTATAAATTAAATACAATATATTCTTTTTTTATAAATATTTTTTCTTTTCCCTCAAAAAAAAAATAAATACTTTTATTCCTATATTTGCTTAACTGCGTGCCC
TGACATTTTTGTCTATATAGTAATTACATAATTACCATGATGCTTAGTAACTAACTAACTAATGGTTTTGTTTTTGAGTGTGAAGGTGCACACACTTTTGGCCGTGCGCAATGTAGATTT
TTCAACCAGAGACTGTTCAACTTGAGCGGCACGGGTAGCCCTGATCCCACGCTGAACGCAACCTATTTGGCGACACTGCAGCAAAACTGTCCTCAAAATGGAAGCGGCAACACTCTGAAC
AACCTCGACCCTTCGTCCCCAGACACCTTCGACAACAACTACTTCCAAAACCTTCTCAGCAATCAGGGCCTTCTCCAAACCGACCAAGAGCTCTTCTCCACCAACGGCGCCGCCACAATC
TCCGTTATCAACAACTTCGCCGCCAACCAAACCGCGTTCTTCCAAGCCTTTGCTCAGTCTATGATTAACATGGGTAATATTAGCCCGTTGACTGGAAGCCGGGGTGAAATCAGATCCGAT
TGTAAGAGGGTCAATGGAAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTTTTACTTATTCCCTATTCACCACCATTTTCTTAGTGCTAACAATCTTTCTTCATCCATCAAATGCTCAACTGAGTTCAACCTTCTACTCCAGCACGTGCCCCAACGTGTCT
TCCGTTGTGCGCAGTGTTGTTCAGCAGGCTCTGCAATCTGATCCTCGTATTGCTGCGAGCCTAACTCGTCTTCATTTTCATGATTGCTTTGTTAAT
GGATGCGATGGATCCATTTTGTTA
GACGTAGGTGGCAACATAACACTGAGCGAGAAAAATGCAGGTCCCAACAACAATTCAGCTCGTGGCTTTGATGTAGTGGACAACATAAAGACATCTGTTGAAAATTCATGCCCTGGTGTT
GTATCTTGTGCTGATATTCTTGCCCTTGCTGCTGAAGCTTCTGTGTCTTTG
GGAGGAGGTCCTTCATGGAACGTACAACTAGGAAGAAGGGACGGTTTGATTGCAAACCAATCTGGTGCC
AACACATCCATTCCCAATCCAACTGAAAGCCTGGCCAATGTCACAGCCAAGTTTGCTGCAGTTGGCTTAAACGTAACTGATCTCGTTGCATTATCTG
GTGCACACACTTTTGGCCGTGCG
CAATGTAGATTTTTCAACCAGAGACTGTTCAACTTGAGCGGCACGGGTAGCCCTGATCCCACGCTGAACGCAACCTATTTGGCGACACTGCAGCAAAACTGTCCTCAAAATGGAAGCGGC
AACACTCTGAACAACCTCGACCCTTCGTCCCCAGACACCTTCGACAACAACTACTTCCAAAACCTTCTCAGCAATCAGGGCCTTCTCCAAACCGACCAAGAGCTCTTCTCCACCAACGGC
GCCGCCACAATCTCCGTTATCAACAACTTCGCCGCCAACCAAACCGCGTTCTTCCAAGCCTTTGCTCAGTCTATGATTAACATGGGTAATATTAGCCCGTTGACTGGAAGCCGGGGTGAA
ATCAGATCCGATTGTAAGAGGGTCAATGGAAGTTAA

Retrieve as FASTA