Entry information : GmPrx94 (Glyma01g09650.1)
Entry ID 9029
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-19 (Christophe Dunand)
Peroxidase information: GmPrx94 (Glyma01g09650.1)
Name (synonym) GmPrx94 (Glyma01g09650.1)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx94
start..stop
S start..stop
GmPrx111 647 0 1..337 1..337
MtPrx40 592 0 10..337 11..338
MePrx12 541 0 1..337 3..340
PpePrx72 536 0 1..337 1..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11971182..11971412 231 N° 2 11971982..11972173 192 N° 3 11972307..11972472 166 N° 4 11973367..11973791 425
join(11971182..11971412,11971982..11972173,11972307..11972472,11973367..11973791 )


exon

Literature and cross-references GmPrx94 (Glyma01g09650.1)
DNA ref. Phytozome 12:   Gm01 (11971182..11973791)
Protein sequence: GmPrx94 (Glyma01g09650.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (310)
PWM (Da):   %s   37066.27 (33881.7) Transmb domain:   %s   o10-27i
PI (pH):   %s   5.01 (4.77) Peptide Signal:   %s   cut: 28 range:28-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNPSFPSKSFMYVVLIFCFLGATRLYASDPYLTLDYYASSCPTVFDIVRKEMECAVLSDPRNAAMIVRLHFHDCFVQGCDGSVLLDDTITLKGEKNAATNIHSLKGLGIVDKIKNIVESECPGIVSCADILTIAARDAVILVGGPYWDVPVGRKDSVTANFDLANTNLATPDESLLSIIAKFLYQGLSVTDMVALAGAHTIGMAQCKNFRSRIYGDFESTSMKNPISESHLSNLKSVCPPMGGGDNNITAMDYMTPNLFDNSFYQLLLNGEGLLNSDQEMYSSVFGIETRQLVKKYAADPLAFFRQFSESMVKMGNITNSESFFTGEVRKNCRFVNT*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCTTCCTTTCCTTCAAAATCCTTTATGTATGTTGTTCTTATCTTTTGCTTTCTTGGTGCCACCAGATTGTATGCAAGTGACCCTTATCTAACACTGGATTACTATGCATCAAGT
TGCCCCACCGTGTTTGACATTGTTAGGAAAGAAATGGAATGTGCAGTGCTTTCTGATCCCCGCAATGCAGCCATGATAGTTCGGCTACACTTCCATGACTGCTTTGTTCAG
GTATATAAC
TTTATTATCTAGTATTGGCAGTGTTTTCACGTGAATAAACAAATTACATAGTACTAGTCATAGTTACTTAATTCTCTCAATAACTTGTATACTGGCTACCAAATTCATTGAATCACGTAT
TGAAATCTATTTAAAGTCTTATACACACATATTAACATATATAATGTACAGAGTAAATTACACCAATATTCTCTGAAGTTTTTGTCAGATTGCACATAATATCTTATTTTCCTATCCCTA
CACTAATTCCCTTAATTGTTTAAAAAACATTACATCATATACCCATACAAGGGAGATTGTTGTAAGCACAAGGTGTCGTGTGCAATATGAAAAGGAAAAAAAAAATCAAGGATATCAGCC
TAATTTACTTTAATGTATAAAGTGGATAACCAACCGTGTACCGACACTAACCATATGTAGTCATATTTTATACCCGTACCACGTACCTGGTAATTATGGTACTATTAGTAGTTCTATAGT
TTCATTTTTAGAAAGCCAATATGAATCTAATGAGAAAAAAGTAAATACACACTAACAAAATGTTACATTCTTGGGCTCAGGGCTGCGATGGATCAGTTTTGCTTGATGACACAATCACAC
TTAAAGGTGAGAAAAACGCCGCTACCAACATCCACTCTTTAAAAGGCTTGGGAATTGTTGATAAGATCAAGAACATAGTTGAATCAGAGTGCCCTGGAATTGTTTCTTGCGCTGATATTC
TCACTATTGCAGCCAGAGATGCTGTTATTCTG
GTAAAAGACACTGCTTGCTTCTAGATTTTATCACATAGTTTATACCATGTTTTTTCATAAGCTTTAATCTTTAATTTTCTACATATAA
GTTACTAGAATTATGCACATGCCTCTGTCCTCTGATCTTTTGCAGGTAGGTGGACCTTACTGGGATGTTCCTGTGGGAAGGAAGGATTCTGTCACTGCAAATTTTGATCTTGCCAACACC
AATCTTGCCACTCCAGATGAGAGCCTTCTGTCTATCATTGCCAAGTTTCTTTACCAAGGACTATCTGTCACGGATATGGTAGCCCTTGCAG
GTATATTAATGAATAAAACTTTGAAGGTT
TAAATATGTTTTTAATTTTCACAAATATGACAAATTTTGATTTTAGTCCTTTAAAAAATCTTTTGTCAATTTTAGTCCTCATAAATTTATTTATTTTAAATAGTATCTATCATCATTTAA
TGATGATAAGACATGCATTTAGATATGTCACATTAACAATCATTCTAAGATCTGATATACTTAGATATATGTCTCGTCATTTGTAAATGATGATACATATCATTTTTGAAACTTTGAAAT
ATATCAAGACCTAAATGAATATTATTAAACATTTGGAATATTTATGCGAATTAACAAATATATTAAACTAACTTTGAAAAACAAAAAAAGAAAATTTATTGGCTCTTCATTCAGATCCTG
AAGACAGTGGGTTTTGTCTGCAGTTGTAGTTGCTACCAGTAGCAGCCAAAACTATATCATGTAAATATGACAACTTCAAGTAAACACGGCAGACAGCTAGACTGCCTAAATAGAACATAC
AAATGTTTGAATTAAAACAAGGAAATAACTAACTGAATATATGAATTTCATGACTAATAGACCTTAACATTTTTTTAACTAGTAATGTCACTTATGAGATAGATACAGTTTAATAAACAA
ATTCTAGATGAAGTGTATGTTACCATCAGGTATATTATTATTCTAGCAAGCTTATAAAGAGTAGTGTCAACTAAGTTTCTAAAAAGATTGTCTTAAGTTTTAACCACAAAAAAACTCATA
CAATCTATTAAGTTGAACTAACAATAATCATAATATGATCACTAGTATCGTGATCTACCTCCTCATCTTGCCCTGCTGCTCCAAAGATACCTAGCTGTATGTAGCACTTTCTTCATACCA
CATTTTCTGATCACTAAGCCTGCAGGAGCCCACACCATTGGCATGGCACAGTGTAAGAATTTCCGGTCAAGAATTTACGGAGACTTTGAATCAACTTCAATGAAAAATCCAATCTCTGAG
AGTCACCTCAGCAACTTAAAATCTGTTTGTCCACCTATGGGGGGAGGAGACAATAACATAACAGCAATGGACTACATGACACCTAATCTCTTTGACAATTCTTTCTACCAATTACTACTA
AATGGGGAGGGACTTCTCAACTCAGACCAAGAAATGTACTCAAGTGTGTTTGGAATTGAAACTAGACAGCTTGTGAAGAAGTATGCAGCAGACCCTCTTGCTTTTTTCCGACAATTCTCG
GAGTCAATGGTGAAAATGGGAAATATCACAAACTCAGAAAGCTTCTTCACAGGGGAAGTTAGGAAGAACTGCAGATTTGTGAACACATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCTTCCTTTCCTTCAAAATCCTTTATGTATGTTGTTCTTATCTTTTGCTTTCTTGGTGCCACCAGATTGTATGCAAGTGACCCTTATCTAACACTGGATTACTATGCATCAAGT
TGCCCCACCGTGTTTGACATTGTTAGGAAAGAAATGGAATGTGCAGTGCTTTCTGATCCCCGCAATGCAGCCATGATAGTTCGGCTACACTTCCATGACTGCTTTGTTCAG
GGCTGCGAT
GGATCAGTTTTGCTTGATGACACAATCACACTTAAAGGTGAGAAAAACGCCGCTACCAACATCCACTCTTTAAAAGGCTTGGGAATTGTTGATAAGATCAAGAACATAGTTGAATCAGAG
TGCCCTGGAATTGTTTCTTGCGCTGATATTCTCACTATTGCAGCCAGAGATGCTGTTATTCTG
GTAGGTGGACCTTACTGGGATGTTCCTGTGGGAAGGAAGGATTCTGTCACTGCAAAT
TTTGATCTTGCCAACACCAATCTTGCCACTCCAGATGAGAGCCTTCTGTCTATCATTGCCAAGTTTCTTTACCAAGGACTATCTGTCACGGATATGGTAGCCCTTGCAG
GAGCCCACACC
ATTGGCATGGCACAGTGTAAGAATTTCCGGTCAAGAATTTACGGAGACTTTGAATCAACTTCAATGAAAAATCCAATCTCTGAGAGTCACCTCAGCAACTTAAAATCTGTTTGTCCACCT
ATGGGGGGAGGAGACAATAACATAACAGCAATGGACTACATGACACCTAATCTCTTTGACAATTCTTTCTACCAATTACTACTAAATGGGGAGGGACTTCTCAACTCAGACCAAGAAATG
TACTCAAGTGTGTTTGGAATTGAAACTAGACAGCTTGTGAAGAAGTATGCAGCAGACCCTCTTGCTTTTTTCCGACAATTCTCGGAGTCAATGGTGAAAATGGGAAATATCACAAACTCA
GAAAGCTTCTTCACAGGGGAAGTTAGGAAGAACTGCAGATTTGTGAACACATAG

Retrieve as FASTA