Entry information : GmPrx96 (Glyma01g32270.1)
Entry ID 9031
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-19 (Christophe Dunand)
Peroxidase information: GmPrx96 (Glyma01g32270.1)
Name (synonym) GmPrx96 (Glyma01g32270.1)
Class Class III peroxidase    [Orthogroup: Prx040]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx96
start..stop
S start..stop
GmPrx133 582 0 1..319 1..319
GmPrx129 532 0 1..319 1..319
GmPrx132 531 0 1..319 1..319
GmPrx130 529 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43720530..43720745 216 N° 2 43721016..43721210 195 N° 3 43721746..43722294 549  
join(43720530..43720745,43721016..43721210,43721746..43722294)


exon

Literature and cross-references GmPrx96 (Glyma01g32270.1)
DNA ref. Phytozome 12:   Gm01 (43720530..43722294)
Protein sequence: GmPrx96 (Glyma01g32270.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (294)
PWM (Da):   %s   35144.64 (32111.2) Transmb domain:   %s   i7-24o
PI (pH):   %s   8.23 (8.04) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFHKYFSFVLYVFVFAAFPTTAFSKLSHDYYDYTCPNALSTIRSVVEAAVQKERRMGASLLRLHFHDCFVNGCDGSILLDPSSTIDSEKNALPNFQSARGFEVVDEIKEAVDEACGKPVVSCADILAVAARDSVVALGGPSWKVRLGRRDSTTASREAANANIPAPFFSLSELINNFKSHGLNERDLVALSGGHTIGNARCATFRDHIYNDSNINPHFAKELKHICPREGGDSNLAPLDRSAARFDSAYFSDLVHKKGLLHSDQELFNGGSTDALVKIYSHNTKGFHKDFAKSMIKMGNIKPLTGNRGEIRLNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect prediction from phytozome ( 5' end is missing). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCCATAAGTATTTCTCTTTTGTCCTCTATGTCTTTGTGTTTGCAGCTTTTCCAACAACAGCATTTTCAAAATTGTCACATGATTACTATGACTACACGTGCCCTAACGCTTTA
AGCACCATTAGAAGCGTTGTGGAGGCTGCGGTGCAAAAAGAGCGCCGTATGGGCGCATCCTTGCTACGCTTGCACTTCCATGATTGTTTTGTTAAT
GTAAGACTTTCTATATTTGTGTGT
TATTCATGTATGTATACAACTATATGGTTTTTTTTATCGATAAATATTAATTCTTAATTATTAATTTTTTGTTAATGAAAGAATTGAATTTACTATTTTTTTTCTCCTTTTCTCTTTTCT
TCTTTTACAATCAAATCAACCTTATAATTTCATATTATATATATTTGTATAATATTAATAATAAGTTCTTAGTTGATGTAATTTGTGTCTGATAAATTACTTGGTTTTGTAATGGTGATT
CATCAGGGTTGTGATGGTTCAATTCTACTAGACCCTTCATCCACCATTGACAGTGAAAAGAATGCACTCCCTAATTTTCAATCTGCTAGAGGATTTGAAGTGGTGGATGAGATCAAGGAG
GCTGTGGACGAAGCATGTGGAAAACCAGTTGTTTCTTGCGCTGACATATTGGCTGTTGCCGCTCGTGACTCTGTCGTTGCG
GTGAGTAACACTACATACTACCACTAATTAATGCTCTGT
TGAATGATTATTAGTACAGTTTATATTTTAATTGTGTGGTTGTGCCTATAGATAAGATAGTAATGCTGTCATTGCTTTTAAAATTTTGACTCAGTAAGCATATGAATTTTTAAATATATA
GAATAGAACTTCGAATATTTTACAACATAGTTTTTCATTTCATTACACCAATTGAAAAAGAGTACGTCTTTTTTACTCTTTCTTGTAAAGAGAGATGGTATAAATTATTTTTACATCATG
AAAGTCATAAGAAGATAAGGGAGAAGATATCAATAGGATTAATAATATGATGAACTTACAGAAAATTTTTAAAATGGGTATTGTAAAAAATATTATATGAAGATAAATTAAACACTAAAT
TATTTGAGTGTGATCATGTGGGTTGATTTAGACATCCATCATCCATGTTCTAATGAAATTTGAGTAATAACATTTAACGTTTGTTTTTAGTAACATATGAGTATGAGATTAACAATTATG
TGCATGCCCAATGCAGTTAGGAGGGCCATCATGGAAGGTGAGACTTGGTAGAAGAGACTCCACCACAGCAAGCCGTGAAGCAGCAAATGCAAACATTCCAGCACCATTTTTCAGCCTTTC
GGAACTGATCAACAACTTCAAGAGCCACGGCCTAAACGAGAGGGACCTTGTTGCTCTTTCAGGAGGCCACACAATTGGAAATGCACGTTGTGCTACCTTTAGAGACCATATCTACAATGA
CTCCAACATCAACCCCCATTTTGCAAAAGAGCTTAAACACATTTGCCCTAGAGAAGGAGGTGACTCCAACCTTGCTCCTTTGGACCGCTCAGCAGCGCGATTTGATTCGGCCTACTTCTC
TGATTTGGTTCACAAGAAAGGGCTTCTTCACTCCGATCAGGAACTGTTCAATGGTGGTTCTACTGATGCATTGGTTAAAATATATAGCCACAATACCAAGGGTTTCCACAAGGACTTCGC
AAAATCTATGATTAAGATGGGAAACATAAAGCCTCTTACCGGGAATCGAGGTGAAATTCGTTTGAATTGCAGGAGAGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCCATAAGTATTTCTCTTTTGTCCTCTATGTCTTTGTGTTTGCAGCTTTTCCAACAACAGCATTTTCAAAATTGTCACATGATTACTATGACTACACGTGCCCTAACGCTTTA
AGCACCATTAGAAGCGTTGTGGAGGCTGCGGTGCAAAAAGAGCGCCGTATGGGCGCATCCTTGCTACGCTTGCACTTCCATGATTGTTTTGTTAAT
GGTTGTGATGGTTCAATTCTACTA
GACCCTTCATCCACCATTGACAGTGAAAAGAATGCACTCCCTAATTTTCAATCTGCTAGAGGATTTGAAGTGGTGGATGAGATCAAGGAGGCTGTGGACGAAGCATGTGGAAAACCAGTT
GTTTCTTGCGCTGACATATTGGCTGTTGCCGCTCGTGACTCTGTCGTTGCG
TTAGGAGGGCCATCATGGAAGGTGAGACTTGGTAGAAGAGACTCCACCACAGCAAGCCGTGAAGCAGCA
AATGCAAACATTCCAGCACCATTTTTCAGCCTTTCGGAACTGATCAACAACTTCAAGAGCCACGGCCTAAACGAGAGGGACCTTGTTGCTCTTTCAGGAGGCCACACAATTGGAAATGCA
CGTTGTGCTACCTTTAGAGACCATATCTACAATGACTCCAACATCAACCCCCATTTTGCAAAAGAGCTTAAACACATTTGCCCTAGAGAAGGAGGTGACTCCAACCTTGCTCCTTTGGAC
CGCTCAGCAGCGCGATTTGATTCGGCCTACTTCTCTGATTTGGTTCACAAGAAAGGGCTTCTTCACTCCGATCAGGAACTGTTCAATGGTGGTTCTACTGATGCATTGGTTAAAATATAT
AGCCACAATACCAAGGGTTTCCACAAGGACTTCGCAAAATCTATGATTAAGATGGGAAACATAAAGCCTCTTACCGGGAATCGAGGTGAAATTCGTTTGAATTGCAGGAGAGTGAACTAA

Retrieve as FASTA