Entry information : MePrx101 (cassava4.1_028049m)
Entry ID 9062
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-31 (Achraf Jemmat)
Peroxidase information: MePrx101 (cassava4.1_028049m)
Name (synonym) MePrx101 (cassava4.1_028049m)
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx101
start..stop
S start..stop
RcPrx57 486 3e-175 1..318 1..319
LePrx22 478 6e-172 1..318 1..318
PtPrx74 475 8e-171 1..318 1..320
RcPrx56 469 2e-168 1..318 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 282438..282650 213 N° 2 282743..282937 195 N° 3 283020..283568 549  
join(282438..282650,282743..282937,283020..283568)


exon

Literature and cross-references MePrx101 (cassava4.1_028049m)
DNA ref. Phytozome 12:   scaffold03718 (282438..283568)
Protein sequence: MePrx101 (cassava4.1_028049m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (296)
PWM (Da):   %s   34825.66 (32315.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.55 (8.39) Peptide Signal:   %s   cut: 24 range:24-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRSNFFLYGYLFLVLAATASSSTLSPSFYDRVCPNALQTIKRVVEDAVSRERRMGASLLRLHFHDCFVNGCDASILLDPSPTIDSEKNAIPNANSARGFEVIDQIKYEVDKACGGAVVSCADILAVAARDSVVALGGPTWKVQLGRRDSTTASRIAAETDLPSPFADLPVLINGFKKQGLDEKDLVVLSGAHTLGFSQCGAFKKRIYNETNIDPYFAQKRRATCPPDGGNTNLAPLDPTPARFDIAYFTNLRKKRGLLHSDQELFNGGSTDELVNIYSYNPRAFWKDFANSMIKMGNIKTLTGNQGQVRLNCKMVNW

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACGTAGCAACTTTTTTCTTTATGGTTACCTTTTTTTGGTCCTCGCTGCAACAGCTTCTTCTTCTACACTATCTCCCTCTTTTTATGATAGAGTTTGTCCCAATGCTTTACAA
ACTATCAAACGAGTTGTTGAAGATGCAGTCTCCAGAGAACGACGCATGGGTGCTTCTTTATTGCGTCTGCACTTCCATGACTGTTTTGTTAAT
GTATGTACAGTGAGATACTTGAGAAAA
ATTCTCTTAGTAATTAGTTTTTTTAATCCTTCTCATGTGAATTGAATTGGGATTTTGTTGTATAGGGATGTGATGCTTCAATTCTTTTGGATCCTTCTCCCACCATTGATAGTGAAAAAA
ATGCCATCCCTAATGCAAATTCTGCGAGAGGATTTGAAGTTATTGATCAAATTAAGTATGAGGTCGACAAAGCCTGCGGCGGTGCAGTGGTCTCTTGCGCAGATATATTAGCAGTTGCAG
CCCGTGATTCTGTTGTTGCG
GTATATATCTAGCTTTATGCATGCAAATTATCTCGTCCATTATTGTTGTTTTGATTTTCTTTTTTCATTTGAATATGCGCAGCTTGGTGGCCCAACATGG
AAGGTGCAACTGGGGAGGAGAGACTCAACCACAGCTAGCAGAATTGCAGCAGAAACTGACCTCCCATCACCATTTGCAGACCTTCCAGTGCTCATTAATGGCTTCAAGAAGCAAGGTCTT
GACGAGAAAGACCTTGTTGTTCTATCTGGTGCTCATACTTTAGGTTTCTCACAGTGCGGTGCTTTCAAGAAGAGGATCTACAATGAAACTAATATTGATCCATATTTTGCACAAAAACGA
AGAGCAACTTGTCCACCCGATGGAGGTAATACAAATCTTGCACCTCTAGACCCAACACCTGCACGCTTTGACATTGCATACTTCACCAACTTGAGAAAGAAGAGAGGGCTTCTTCATTCT
GATCAAGAGCTCTTCAATGGCGGCTCTACTGATGAGCTTGTGAATATTTATAGCTATAATCCACGAGCTTTCTGGAAAGATTTTGCCAACTCTATGATTAAGATGGGGAATATAAAAACG
TTGACTGGAAATCAAGGCCAAGTTCGTTTGAACTGCAAGATGGTGAACTGG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACGTAGCAACTTTTTTCTTTATGGTTACCTTTTTTTGGTCCTCGCTGCAACAGCTTCTTCTTCTACACTATCTCCCTCTTTTTATGATAGAGTTTGTCCCAATGCTTTACAA
ACTATCAAACGAGTTGTTGAAGATGCAGTCTCCAGAGAACGACGCATGGGTGCTTCTTTATTGCGTCTGCACTTCCATGACTGTTTTGTTAAT
GGATGTGATGCTTCAATTCTTTTGGAT
CCTTCTCCCACCATTGATAGTGAAAAAAATGCCATCCCTAATGCAAATTCTGCGAGAGGATTTGAAGTTATTGATCAAATTAAGTATGAGGTCGACAAAGCCTGCGGCGGTGCAGTGGTC
TCTTGCGCAGATATATTAGCAGTTGCAGCCCGTGATTCTGTTGTTGCG
CTTGGTGGCCCAACATGGAAGGTGCAACTGGGGAGGAGAGACTCAACCACAGCTAGCAGAATTGCAGCAGAA
ACTGACCTCCCATCACCATTTGCAGACCTTCCAGTGCTCATTAATGGCTTCAAGAAGCAAGGTCTTGACGAGAAAGACCTTGTTGTTCTATCTGGTGCTCATACTTTAGGTTTCTCACAG
TGCGGTGCTTTCAAGAAGAGGATCTACAATGAAACTAATATTGATCCATATTTTGCACAAAAACGAAGAGCAACTTGTCCACCCGATGGAGGTAATACAAATCTTGCACCTCTAGACCCA
ACACCTGCACGCTTTGACATTGCATACTTCACCAACTTGAGAAAGAAGAGAGGGCTTCTTCATTCTGATCAAGAGCTCTTCAATGGCGGCTCTACTGATGAGCTTGTGAATATTTATAGC
TATAATCCACGAGCTTTCTGGAAAGATTTTGCCAACTCTATGATTAAGATGGGGAATATAAAAACGTTGACTGGAAATCAAGGCCAAGTTCGTTTGAACTGCAAGATGGTGAACTGG

Retrieve as FASTA