Entry information : MePrx108 (cassava4.1_029294m)
Entry ID 9067
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-06 (Christophe Dunand)
Peroxidase information: MePrx108 (cassava4.1_029294m)
Name (synonym) MePrx108 (cassava4.1_029294m)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx108
start..stop
S start..stop
MePrx110 643 0 1..329 1..329
RcPrx43 572 0 1..329 1..330
MePrx97 567 0 1..329 1..328
PtPrx91 494 3e-178 1..329 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 264809..265030 222 N° 2 265112..265297 186 N° 3 265381..265546 166 N° 4 265628..266040 413
join(264809..265030,265112..265297,265381..265546,265628..266040)


exon

Literature and cross-references MePrx108 (cassava4.1_029294m)
DNA ref. Phytozome 12:   scaffold12753 (264809..266040)
Protein sequence: MePrx108 (cassava4.1_029294m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (302)
PWM (Da):   %s   35292.2 (32465.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.38 (8.20) Peptide Signal:   %s   cut: 28 range:28-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAAKSFSALLLQITIVLLLVFNPANAQLKVGFYSNTCPKAEAIVKDVIDGVLSVAPSLAGPLLRMHFHDCFVRGCDGSVLLNSTTQQAEKDGPPNLTLRGYQVIDRVKSALEKACPGVVSCADIVAIVARDVTVASKGLRWEVETGRRDGRVSIAAETLTNLIAPNANITTIITRFQAKGLSVKDAVVLSGSHTIGTSHCSSFNSRLYNFTGKGTDNDFDPTLDSEYVKELKSKCKPGDQNSLVEMDPGSFRTFDADYYTLVSKRRGLFQSDAALLDNSITKAYVNLQVATQGSTFLKDFGDSMVKMGRVDVLTGTAGEIRKVCSKV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTGCAAAGTCATTTTCAGCTCTTCTTCTCCAAATCACCATTGTTTTGTTATTGGTATTTAACCCTGCGAATGCTCAACTGAAAGTAGGGTTTTACTCCAATACATGCCCAAAA
GCTGAGGCCATTGTTAAGGATGTAATCGATGGAGTCCTCTCAGTGGCTCCTTCCCTTGCAGGCCCCTTGTTGAGGATGCATTTTCATGATTGTTTTGTTAGG
GTAAGCAAACAACAGATG
AAAATACATCCTTTTCTACAAAAAATGGAGCTTATGCACATGTCATTTCATTTGTATTTGCAGGGTTGTGATGGGTCAGTGCTATTGAATTCTACTACTCAGCAAGCTGAAAAAGATGGA
CCTCCAAACCTAACTCTTCGAGGATACCAGGTGATCGACAGAGTCAAATCTGCATTAGAAAAGGCTTGTCCTGGTGTAGTTTCATGCGCAGACATCGTGGCTATTGTGGCTAGAGACGTC
ACCGTTGCG
GTAATTAGAAGTTTATTCTTCCATTTAAATTTTCTTTAAGCAAAAAATCAAATGAGTTATATAAACAAAATTTATCATCTCAGAGCAAGGGATTGCGCTGGGAAGTTGAAA
CTGGAAGAAGAGATGGAAGGGTTTCTATCGCTGCTGAAACCCTTACCAATCTGATAGCTCCTAACGCAAACATTACAACGATAATTACAAGATTTCAAGCTAAGGGTCTGAGCGTAAAAG
ACGCAGTGGTACTATCAG
GTACGTAAAAACCCATGCAATGCCTGTAAGAAAAGAACCCCCATGCTGTGGACGTAATTCTGATCCCTTTGTGTTACACAGGTTCTCACACCATCGGTACTT
CTCACTGCTCATCATTCAATTCCAGGCTATACAACTTCACCGGAAAGGGAACCGATAATGACTTTGATCCCACATTGGATTCTGAATATGTAAAAGAGTTGAAGAGCAAATGTAAGCCAG
GAGATCAGAATTCGCTGGTAGAAATGGATCCAGGGAGCTTCAGGACATTTGATGCAGACTATTATACACTTGTGAGTAAACGGAGGGGGCTGTTTCAGTCAGATGCAGCTCTTCTTGACA
ACAGCATCACAAAAGCTTACGTTAATCTTCAGGTGGCCACACAGGGATCCACTTTCTTGAAAGACTTCGGTGATTCCATGGTGAAAATGGGAAGGGTCGATGTTCTTACTGGTACAGCAG
GTGAAATCAGGAAAGTGTGCAGCAAAGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTGCAAAGTCATTTTCAGCTCTTCTTCTCCAAATCACCATTGTTTTGTTATTGGTATTTAACCCTGCGAATGCTCAACTGAAAGTAGGGTTTTACTCCAATACATGCCCAAAA
GCTGAGGCCATTGTTAAGGATGTAATCGATGGAGTCCTCTCAGTGGCTCCTTCCCTTGCAGGCCCCTTGTTGAGGATGCATTTTCATGATTGTTTTGTTAGG
GGTTGTGATGGGTCAGTG
CTATTGAATTCTACTACTCAGCAAGCTGAAAAAGATGGACCTCCAAACCTAACTCTTCGAGGATACCAGGTGATCGACAGAGTCAAATCTGCATTAGAAAAGGCTTGTCCTGGTGTAGTT
TCATGCGCAGACATCGTGGCTATTGTGGCTAGAGACGTCACCGTTGCG
AGCAAGGGATTGCGCTGGGAAGTTGAAACTGGAAGAAGAGATGGAAGGGTTTCTATCGCTGCTGAAACCCTT
ACCAATCTGATAGCTCCTAACGCAAACATTACAACGATAATTACAAGATTTCAAGCTAAGGGTCTGAGCGTAAAAGACGCAGTGGTACTATCAG
GTTCTCACACCATCGGTACTTCTCAC
TGCTCATCATTCAATTCCAGGCTATACAACTTCACCGGAAAGGGAACCGATAATGACTTTGATCCCACATTGGATTCTGAATATGTAAAAGAGTTGAAGAGCAAATGTAAGCCAGGAGAT
CAGAATTCGCTGGTAGAAATGGATCCAGGGAGCTTCAGGACATTTGATGCAGACTATTATACACTTGTGAGTAAACGGAGGGGGCTGTTTCAGTCAGATGCAGCTCTTCTTGACAACAGC
ATCACAAAAGCTTACGTTAATCTTCAGGTGGCCACACAGGGATCCACTTTCTTGAAAGACTTCGGTGATTCCATGGTGAAAATGGGAAGGGTCGATGTTCTTACTGGTACAGCAGGTGAA
ATCAGGAAAGTGTGCAGCAAAGTTAAC

Retrieve as FASTA