Entry information : MePrx110 (cassava4.1_029372m)
Entry ID 9069
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-06 (Christophe Dunand)
Peroxidase information: MePrx110 (cassava4.1_029372m)
Name (synonym) MePrx110 (cassava4.1_029372m)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx110
start..stop
S start..stop
MePrx108 643 0 1..329 1..329
MePrx97 566 0 1..329 1..328
RcPrx43 565 0 1..329 1..330
PtPrx91 484 8e-174 10..329 11..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 268852..269073 222 N° 2 269154..269339 186 N° 3 269442..269607 166 N° 4 269692..270104 413
join(268852..269073,269154..269339,269442..269607,269692..270104)


exon

Literature and cross-references MePrx110 (cassava4.1_029372m)
DNA ref. Phytozome 12:   scaffold12753 (268852..270104)
Protein sequence: MePrx110 (cassava4.1_029372m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (302)
PWM (Da):   %s   35353.33 (32489.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.72 (8.55) Peptide Signal:   %s   cut: 28 range:28-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSATKSLSALLLQFTFVLLLAFSPVNAQLKVGFYSKTCPKAEAIAKEVIDGVLSVAPSLAGPLLRMHFHDCFVRGCDGSVLLNSTTQQAEKDGPPNLTLRGYQVIDRVKSALEKACPGVVSCADIVAIVARDVTVATKGLRWEVETGRRDGRVSIAAETLTNLVAPNANITTIITRFQAKGLSVKDAVILLGSHTIGTSHCSSFNSRLYNFTGKGTDNDFDPTLDSEYVKELKIKCKPGDQNSLVEMDPGSFRTFDSSYYTLVSKRRGLFQSDAALLDNSVTKAYINLQVATQGSTFLKDFGDSMVKMGRVDVLTGTAGEIRKVCGKV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTACAAAGTCACTTTCAGCTCTTCTTCTCCAATTCACCTTTGTTTTATTATTGGCATTTAGCCCTGTGAATGCTCAACTCAAAGTAGGATTTTACTCCAAGACATGCCCAAAA
GCTGAGGCCATTGCTAAGGAGGTTATCGATGGAGTCCTCTCAGTGGCTCCTTCCCTCGCAGGCCCCTTGTTGAGGATGCATTTTCATGATTGTTTTGTTAGG
GTAAGCAAACAAGAGATG
AAAATACATCCTTTTCTACAAAAATGGAGCTTATTTACATGTAATTTCATTTGTATTTGCAGGGTTGTGATGGGTCAGTGCTATTGAACTCTACTACTCAGCAAGCTGAAAAAGATGGAC
CTCCAAATCTAACCCTTCGAGGATACCAAGTGATCGACAGAGTCAAGTCTGCATTAGAAAAGGCTTGTCCTGGTGTAGTTTCATGCGCAGACATCGTGGCTATTGTGGCTAGAGACGTCA
CCGTCGCG
GTAATTAGCAGTTTATTCTTCCTTTGAAAACTTCTTTAAGCAAAAATTTAAATGAGTGTGAAAAAGAATGATTGATTATATGAACCAAATTTATCATCTCAGACAAAGGGAT
TACGCTGGGAAGTTGAAACTGGAAGAAGAGATGGGAGGGTTTCTATCGCAGCTGAAACCCTTACAAATCTGGTAGCTCCTAATGCAAACATTACAACGATAATTACAAGATTTCAAGCTA
AGGGTCTGAGCGTAAAAGACGCGGTGATACTATTAG
GTACGTAAAAACCATGCACTGCAGATCCGTAAGCAAACAACCCTCATGCAGTGGACGTAATTCTGATCCTTTTGTGTTACGCAG

GTTCTCACACCATCGGTACTTCTCACTGCTCATCATTCAACTCCAGGCTATATAACTTCACAGGAAAGGGAACCGATAATGACTTTGATCCCACACTGGATTCTGAATATGTAAAAGAGT
TGAAGATAAAGTGCAAGCCAGGAGATCAGAATTCATTGGTGGAAATGGATCCAGGGAGCTTCAGGACATTTGATTCAAGTTATTATACACTTGTGAGTAAAAGAAGGGGGCTTTTTCAGT
CTGATGCAGCTCTTCTTGACAACAGTGTGACAAAAGCTTACATTAATCTTCAGGTGGCCACTCAGGGATCCACTTTCTTGAAAGACTTTGGTGATTCCATGGTGAAAATGGGAAGGGTCG
ATGTTCTTACTGGTACAGCAGGTGAAATCAGGAAAGTGTGCGGCAAGGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTACAAAGTCACTTTCAGCTCTTCTTCTCCAATTCACCTTTGTTTTATTATTGGCATTTAGCCCTGTGAATGCTCAACTCAAAGTAGGATTTTACTCCAAGACATGCCCAAAA
GCTGAGGCCATTGCTAAGGAGGTTATCGATGGAGTCCTCTCAGTGGCTCCTTCCCTCGCAGGCCCCTTGTTGAGGATGCATTTTCATGATTGTTTTGTTAGG
GGTTGTGATGGGTCAGTG
CTATTGAACTCTACTACTCAGCAAGCTGAAAAAGATGGACCTCCAAATCTAACCCTTCGAGGATACCAAGTGATCGACAGAGTCAAGTCTGCATTAGAAAAGGCTTGTCCTGGTGTAGTT
TCATGCGCAGACATCGTGGCTATTGTGGCTAGAGACGTCACCGTCGCG
ACAAAGGGATTACGCTGGGAAGTTGAAACTGGAAGAAGAGATGGGAGGGTTTCTATCGCAGCTGAAACCCTT
ACAAATCTGGTAGCTCCTAATGCAAACATTACAACGATAATTACAAGATTTCAAGCTAAGGGTCTGAGCGTAAAAGACGCGGTGATACTATTAG
GTTCTCACACCATCGGTACTTCTCAC
TGCTCATCATTCAACTCCAGGCTATATAACTTCACAGGAAAGGGAACCGATAATGACTTTGATCCCACACTGGATTCTGAATATGTAAAAGAGTTGAAGATAAAGTGCAAGCCAGGAGAT
CAGAATTCATTGGTGGAAATGGATCCAGGGAGCTTCAGGACATTTGATTCAAGTTATTATACACTTGTGAGTAAAAGAAGGGGGCTTTTTCAGTCTGATGCAGCTCTTCTTGACAACAGT
GTGACAAAAGCTTACATTAATCTTCAGGTGGCCACTCAGGGATCCACTTTCTTGAAAGACTTTGGTGATTCCATGGTGAAAATGGGAAGGGTCGATGTTCTTACTGGTACAGCAGGTGAA
ATCAGGAAAGTGTGCGGCAAGGTTAAC

Retrieve as FASTA