Entry information : MePrx115 (cassava4.1_030160m)
Entry ID 9073
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2016-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-06 (Achraf Jemmat)
Peroxidase information: MePrx115 (cassava4.1_030160m)
Name (synonym) MePrx115 (cassava4.1_030160m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx115
start..stop
S start..stop
MePrx16 577 0 1..343 5..350
MePrx70 564 0 8..343 2..340
HbPrx01 550 0 1..343 1..346
PtPrx01 478 4e-171 1..343 6..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4462..4683 222 N° 2 4796..4986 191 N° 3 5075..5243 169 N° 4 5373..5822 450
join(4462..4683,4796..4986,5075..5243,5373..5822)


exon

Literature and cross-references MePrx115 (cassava4.1_030160m)
DNA ref. Phytozome 12:   scaffold07430 (4462..5818)
Protein sequence: MePrx115 (cassava4.1_030160m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (316)
PWM (Da):   %s   36291.16 (33451.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.44 (4.37) Peptide Signal:   %s   cut: 28 range:28-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHPSPLTLVVIALYAILFVSSGGLASAQLSPTFYDQSCPNVSSIIRGVIAEALQTDTRIGGSLIRLHFHDCFVQGCDASILLDNSATIESEKEALPNNNSARGFDVVDKMKGRLESACPGVVSCADILAVAAQESVALAGGPIWSTQLGRRDSTTANRSLANTSLPGPFLTLEGLKSAFTAVGLNNDTDLVALSGAHTFGRARCGAFIQRLYNFNNTGLPDPTLNTTYLQTLQQICPQGGNTTVINNLDLTTPDIFDNDYYSNLLAGEGLLQTDQELFSTPGADTVDIVRNFSGNQTAFFESFVVSMLKMGNLNVSTGTAGEIRLNCSKVNGVGADTLLISSM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 15, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCCCTCTCCATTGACGTTGGTGGTGATAGCTTTATACGCAATTCTGTTTGTATCATCGGGAGGCTTGGCCTCTGCTCAGCTATCTCCAACATTTTACGATCAAAGCTGCCCAAAT
GTCTCCTCCATTATCCGTGGAGTCATCGCAGAAGCCCTGCAAACTGATACAAGGATTGGTGGCAGCCTCATCAGGCTTCACTTCCATGACTGCTTTGTCCAA
GTAAACTTTTTGAAGTTC
ATCTCTCTTTTTTTCTTATTTATTTCTTCTCTGATCAGATCAGGCCTTGATTTAGTGAGGATTTCAAATGTGTACGTGTTGATATTGTTGCAGGGCTGTGATGCTTCAATCTTGTTGGAC
AACAGTGCTACTATAGAGAGTGAGAAGGAAGCTCTTCCTAATAATAACTCAGCCAGAGGGTTCGATGTTGTTGATAAAATGAAGGGTAGATTGGAGAGTGCTTGCCCCGGCGTTGTTTCT
TGTGCTGATATTCTCGCTGTTGCAGCTCAAGAATCTGTTGCTTTG
GTAATGTTGGCTTTGGATGTGTTTAGTACAGTTTCTTTTTAATAAGAAATGGATTAATTTTATTAATAATTAGAT
ATTAAGCATGCAGGCAGGAGGGCCAATATGGAGCACTCAACTTGGAAGGAGAGATAGCACAACGGCGAACAGAAGTCTAGCTAATACTAGCCTTCCAGGTCCCTTCTTGACCCTTGAGGG
TCTCAAGTCCGCCTTCACGGCCGTCGGCCTCAACAACGACACTGATCTAGTTGCCCTATCTG
GTAATTTTGAATTATTGTTTTTACATAATACTCTCTAATAACTTATTGCATGACTTTT
TTAATTTTCATTTAATCAATTATTTTATAAGGAAAAAAAAAAATAAACCAGTGATTGCTTGGTATCTACCAGGTGCTCATACATTTGGAAGAGCTCGATGTGGAGCCTTTATCCAACGAT
TATACAACTTCAATAACACTGGTCTCCCAGACCCAACATTAAATACAACCTATTTGCAGACACTTCAACAGATATGTCCTCAAGGAGGAAACACAACTGTAATAAATAATCTCGATCTCA
CAACTCCTGATATTTTTGACAATGATTATTACTCAAATCTTTTAGCTGGGGAAGGCCTTCTCCAGACCGATCAGGAACTGTTTTCAACTCCTGGGGCCGATACTGTTGATATTGTGAGAA
ATTTTAGTGGTAATCAGACTGCTTTCTTTGAAAGCTTTGTGGTGTCCATGCTCAAAATGGGAAATCTCAACGTTTCAACAGGAACAGCTGGAGAGATTCGATTGAACTGTAGTAAAGTTA
ATGGAGTCGGAGCAGACACCCTTCTTATTAGCTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCCCTCTCCATTGACGTTGGTGGTGATAGCTTTATACGCAATTCTGTTTGTATCATCGGGAGGCTTGGCCTCTGCTCAGCTATCTCCAACATTTTACGATCAAAGCTGCCCAAAT
GTCTCCTCCATTATCCGTGGAGTCATCGCAGAAGCCCTGCAAACTGATACAAGGATTGGTGGCAGCCTCATCAGGCTTCACTTCCATGACTGCTTTGTCCAA
GCTGTGATGCTTCAATCT
TGTTGGACAACAGTGCTACTATAGAGAGTGAGAAGGAAGCTCTTCCTAATAATAACTCAGCCAGAGGGTTCGATGTTGTTGATAAAATGAAGGGTAGATTGGAGAGTGCTTGCCCCGGCG
TTGTTTCTTGTGCTGATATTCTCGCTGTTGCAGCTCAAGAATCTGTTGCTTTG
GCAGGAGGGCCAATATGGAGCACTCAACTTGGAAGGAGAGATAGCACAACGGCGAACAGAAGTCTAG
CTAATACTAGCCTTCCAGGTCCCTTCTTGACCCTTGAGGGTCTCAAGTCCGCCTTCACGGCCGTCGGCCTCAACAACGACACTGATCTAGTTGCCCTATCTG
GGTGCTCATACATTTGGA
AGAGCTCGATGTGGAGCCTTTATCCAACGATTATACAACTTCAATAACACTGGTCTCCCAGACCCAACATTAAATACAACCTATTTGCAGACACTTCAACAGATATGTCCTCAAGGAGGA
AACACAACTGTAATAAATAATCTCGATCTCACAACTCCTGATATTTTTGACAATGATTATTACTCAAATCTTTTAGCTGGGGAAGGCCTTCTCCAGACCGATCAGGAACTGTTTTCAACT
CCTGGGGCCGATACTGTTGATATTGTGAGAAATTTTAGTGGTAATCAGACTGCTTTCTTTGAAAGCTTTGTGGTGTCCATGCTCAAAATGGGAAATCTCAACGTTTCAACAGGAACAGCT
GGAGAGATTCGATTGAACTGTAGTAAAGTTAATGGAGTCGGAGCAGACACCCTTCTTATTAGCTCTATGTGA

Retrieve as FASTA