Entry information : MePrx117 (cassava4.1_030233m)
Entry ID 9075
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2016-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-06 (Achraf Jemmat)
Peroxidase information: MePrx117 (cassava4.1_030233m)
Name (synonym) MePrx117 (cassava4.1_030233m)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx117
start..stop
S start..stop
RcPrx31 532 0 1..333 1..335
CpapPrx45 492 7e-177 6..333 12..342
PpePrx08 484 7e-174 1..333 1..332
PtPrx80 479 6e-172 1..333 1..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 91219..91452 234 N° 2 90943..91134 192 N° 3 90635..90800 166 N° 4 89818..90227 410
complement(join(89818..90227,90635..90800,90943..91134,91219..91452))


exon

Literature and cross-references MePrx117 (cassava4.1_030233m)
DNA ref. Phytozome 12:   scaffold11584 (91452..89821)
Protein sequence: MePrx117 (cassava4.1_030233m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (310)
PWM (Da):   %s   36274.16 (33644.7)  
PI (pH):   %s   5.79 (5.39) Peptide Signal:   %s   cut: 24 range:24-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYKQISIFPILLLLALSSTQLATPFPSAYSQLDYYFYDSSCPRLEMIVKYGVWAAIQNETRIAASLLRLHFHDCFVNGCDASILLDDTDKLKGEKNARPNRNSARGFEIIESIKADVERACPSTVSCADIVALVAREAVVLSGGPFWYVPLGRRDGLTASQQAANQNLPGPFDSLQNLTAKFIAKGLDVKDLVVLSGAHTIGFAQCFTFKSRLFNFKGSGKPDPRLDSSSLTNLQGMCPNKDTSNSNLAPLDSSTIYSFDNSYYTNLVSNSVLLESDQALMDDDTTAALVNSYSAYPYLFSNDFAASMVKMGKVGVLTGENGEIRKKCGSVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTACAAACAAATTTCAATCTTCCCCATTTTATTATTGCTAGCATTGTCTTCAACTCAGCTAGCAACTCCTTTCCCTTCTGCCTACAGCCAACTCGACTATTATTTCTACGACAGT
TCATGCCCACGTTTGGAAATGATCGTCAAGTATGGCGTTTGGGCAGCCATCCAGAATGAGACCAGGATTGCTGCCTCCCTCCTTCGCTTGCACTTCCATGATTGTTTTGTTAAT
GTAATA
ATAATATATATTTGCTTTTAAGTAATTTTACAAGTCTTGGTGCATTTTTTGCTATTAATTTTGTTGGATTATTAACAGGGTTGCGATGCGTCAATCCTTCTCGACGACACAGATAAACTC
AAAGGGGAGAAGAACGCTCGTCCAAATCGAAACTCTGCTAGAGGATTTGAAATCATTGAGAGTATAAAAGCAGACGTTGAAAGAGCTTGCCCTTCAACTGTTTCATGTGCTGATATTGTG
GCCCTTGTCGCAAGAGAAGCTGTCGTTTTG
GTAATTAATTAGTCCGTTTCAGTATCACGAGCTAAAACTCGTTAATTATATATATATTGTTTTAAGTATTCTTTTTTTTTTTTCAAAAGT
ATTTTAAGTATTCTATTATTGTTTTGTTTATTATCCTCATTTTTCCGGTCAGTCTGGAGGGCCATTTTGGTATGTTCCCTTAGGCCGGCGAGACGGACTAACGGCTAGTCAGCAGGCAGC
TAATCAAAACTTGCCAGGACCTTTTGATTCACTGCAAAATCTCACTGCTAAGTTCATAGCAAAAGGCCTTGATGTAAAGGATCTTGTGGTCCTCTCAG
GTTCTTCTTCTTCCCTTCTTCA
CCTCTCTCCATGCATTTCATTTCTTATATAATCAAAACAAAGAAATGAAAAAAGAGAAGTTAATAATATTGTGGAAACAACCACATACGCCCATCTTCAATTGCAATATTAAAAAAAAAT
AGAAAAAACACTGTAAATTTAATATGATTCAAGTGTAAAATTTACGTACTAAATTAAAGATAAAATTTCACTAGGATAAAAAAATAATGATATAATATCTCAGAACTCTCAAAATCTTAA
TTCTAATGTGAAAATCGGCCTCGCACTGTGGTAGAACTTTTCGGATGGATTCTTAATTCTTCCCATAAAAAGTGTAGCCAAAATTCTATTCACATGATTAACCAATACGATTATACTTTA
TGTTTCTTTGATTGGTCTCTTACAGGAGCACATACCATAGGTTTTGCTCAGTGCTTCACGTTCAAGAGCAGGCTCTTTAACTTCAAAGGCTCTGGCAAGCCTGATCCTAGGCTTGATTCT
TCATCCCTCACAAACTTGCAAGGCATGTGTCCCAACAAAGATACATCAAACAGCAATCTTGCTCCTCTAGACTCATCAACTATTTACAGCTTTGACAATTCATATTATACCAACCTCGTG
AGCAACTCAGTTCTTCTTGAGTCTGATCAAGCTCTAATGGATGACGACACAACTGCTGCTTTGGTTAATTCATATAGTGCATATCCATATCTTTTTTCCAATGATTTTGCAGCATCCATG
GTGAAGATGGGCAAAGTTGGCGTACTTACGGGGGAAAATGGGGAAATTAGAAAGAAATGTGGGTCTGTAAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTACAAACAAATTTCAATCTTCCCCATTTTATTATTGCTAGCATTGTCTTCAACTCAGCTAGCAACTCCTTTCCCTTCTGCCTACAGCCAACTCGACTATTATTTCTACGACAGT
TCATGCCCACGTTTGGAAATGATCGTCAAGTATGGCGTTTGGGCAGCCATCCAGAATGAGACCAGGATTGCTGCCTCCCTCCTTCGCTTGCACTTCCATGATTGTTTTGTTAAT
GGTTGC
GATGCGTCAATCCTTCTCGACGACACAGATAAACTCAAAGGGGAGAAGAACGCTCGTCCAAATCGAAACTCTGCTAGAGGATTTGAAATCATTGAGAGTATAAAAGCAGACGTTGAAAGA
GCTTGCCCTTCAACTGTTTCATGTGCTGATATTGTGGCCCTTGTCGCAAGAGAAGCTGTCGTTTTG
TCTGGAGGGCCATTTTGGTATGTTCCCTTAGGCCGGCGAGACGGACTAACGGCT
AGTCAGCAGGCAGCTAATCAAAACTTGCCAGGACCTTTTGATTCACTGCAAAATCTCACTGCTAAGTTCATAGCAAAAGGCCTTGATGTAAAGGATCTTGTGGTCCTCTCAG
GAGCACAT
ACCATAGGTTTTGCTCAGTGCTTCACGTTCAAGAGCAGGCTCTTTAACTTCAAAGGCTCTGGCAAGCCTGATCCTAGGCTTGATTCTTCATCCCTCACAAACTTGCAAGGCATGTGTCCC
AACAAAGATACATCAAACAGCAATCTTGCTCCTCTAGACTCATCAACTATTTACAGCTTTGACAATTCATATTATACCAACCTCGTGAGCAACTCAGTTCTTCTTGAGTCTGATCAAGCT
CTAATGGATGACGACACAACTGCTGCTTTGGTTAATTCATATAGTGCATATCCATATCTTTTTTCCAATGATTTTGCAGCATCCATGGTGAAGATGGGCAAAGTTGGCGTACTTACGGGG
GAAAATGGGGAAATTAGAAAGAAATGTGGGTCTGTAAATTAA

Retrieve as FASTA