Entry information : PtPrx03_trichobel (Pxp3-4)
Entry ID 908
Creation 2006-06-23 (Christophe Dunand)
Last sequence changes 2010-07-30 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx03_trichobel (Pxp3-4)
Name (synonym) PtPrx03_trichobel (Pxp3-4)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type Xylem
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx03_trichobel
start..stop
S start..stop
PtPrx03 699 0 1..343 1..343
PtPrx11_Trichobel 655 0 1..343 1..343
PnPrx01 637 0 1..343 1..343
PtPrx33 629 0 1..343 1..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3892040..3892252 213 N° 2 3891759..3891950 192 N° 3 3891353..3891521 169 N° 4 3890805..3891262 458
complement(join(3890805..3891262,3891353..3891521,3891759..3891950,3892040..3892 252))


exon

Literature and cross-references PtPrx03_trichobel (Pxp3-4)
Literature Christensen,J.H., et al The syringaldazine-oxidizing peroxidase PXP 3-4 from poplar xylem: cDNA isolation, characterization and expression
Plant Mol. Biol. 47 (5), 581-593 (2001).
Protein ref. UniProtKB:   Q43101
DNA ref. Phytozome 12:   scaffold_1 (3892252..3890808)
mRNA ref. GenBank:   X97350
Protein sequence: PtPrx03_trichobel (Pxp3-4)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (321)
PWM (Da):   %s   36641.11 (34354.8) Transmb domain:   %s   i7-26o
PI (pH):   %s   4.36 (4.26) Peptide Signal:   %s   cut: 23 range:23-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLSKAIVAAFFFVVLLGGTLAHGQLTPTFYDETCPNVSSIIRNVITETVVSDRRIGGSLIRLHFHDCFVNGCDGSLLLDNTDTIESEKEANGNNNSARGFEVVDRMKALLESACPTTVSCADILAIAAEESVFLAGGPNWTVPLGRRDSTTASRDAANASLPAPFLTLDQLRESFTNVGLNNNTDLVALSGAHTFGRAKCSTFNFRLYDFNGTGAPDPTLDPPFLEALQKLCPENGNGSVITDLDVTTADAFDNKYYSNLQGKRGLLQTDQELFSTPGADDVIALVNAFSANQTAFFESFVESMIRMGNISPLTGTEGEIRLNCRVVNANLAGPDSMLVSSI

Retrieve as FASTA  
Remarks Complete sequence from mRNA. Sub_species="Trichobel". No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAGGCTATAGTTGCAGCCTTTTTCTTTGTAGTTTTGCTTGGAGGAACATTGGCTCATGGCCAGCTTACTCCAACATTTTATGACGAGACATGTCCAAATGTGAGCAGC
ATTATCCGTAATGTCATTACGGAGACAGTGGTATCCGATCGTCGGATTGGAGGCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GTAATTACTTTGAAACATCTTATATTT
GCTTAATTATATTAAACCGTCTATCTAAGTTGTGATTCTCAAGTTTTTTATTTTATTTTCAGGGCTGTGATGGTTCGCTTTTGTTGGACAATACTGATACTATAGAGAGCGAAAAGGAAG
CTAATGGGAACAACAACTCTGCAAGAGGTTTTGAAGTTGTTGATAGAATGAAGGCTTTGTTGGAGAGTGCCTGTCCTACTACTGTTTCCTGTGCTGATATACTCGCTATTGCAGCTGAAG
AATCCGTTTTTTTG
GTATCTTAAGATGATCCCTCAACCCCCCAAAATATAAAATAAATATCTTGCTGTCTAATTCTAGTCAAAGTACGAAGAACACAAATATCATAGTTTATCATAATTG
AATGAAAGAAAGAAGCTGAGATTTACTTAATTTTTTACACGACTTTATGAAGGTTTGGACAAAAAAGGAGTTAAGATAGAAATACGTTGAGAGTTGAAAAGTACTAATCCCCTAACTATG
CATGGTTGCAGGCAGGAGGTCCAAATTGGACAGTTCCATTAGGAAGAAGAGATAGTACAACAGCAAGCCGAGATGCAGCAAATGCTTCCCTTCCAGCCCCTTTTTTAACCCTTGATCAAC
TCAGAGAGAGCTTCACTAATGTCGGCCTTAATAATAATACTGATTTGGTAGCTCTATCTG
GTAAGTATTGTTTGTCAGGCTCGACTCTAAACTGTAAAACTCTGTTATAATTGATTCTCC
TTTGATGTAATTTCCTTTTTATCTTCTCAGGTGCTCACACATTTGGAAGGGCAAAATGTTCTACATTCAACTTCCGATTGTATGATTTCAATGGCACCGGTGCTCCTGACCCAACATTGG
ACCCGCCTTTTCTAGAAGCTCTTCAGAAATTATGTCCCGAAAATGGAAATGGGAGTGTGATAACAGATCTTGATGTCACAACAGCTGATGCCTTTGACAATAAGTACTACTCCAATCTGC
AAGGTAAGCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCCGGGGCAGATGATGTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTTTG
TGGAGTCCATGATAAGAATGGGAAATATCAGCCCTCTGACAGGAACTGAAGGGGAGATCAGATTGAACTGCAGGGTAGTCAATGCAAACCTGGCTGGGCCAGATAGCATGCTTGTTAGCT
CAATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAGGCTATAGTTGCAGCCTTTTTCTTTGTAGTTTTGCTTGGAGGAACATTGGCTCATGGCCAGCTTACTCCAACATTTTATGACGAGACATGTCCAAATGTGAGCAGC
ATTATCCGTAATGTCATTACGGAGACAGTGGTATCCGATCGTCGGATTGGAGGCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GGCTGTGATGGTTCGCTTTTGTTGGAC
AATACTGATACTATAGAGAGCGAAAAGGAAGCTAATGGGAACAACAACTCTGCAAGAGGTTTTGAAGTTGTTGATAGAATGAAGGCTTTGTTGGAGAGTGCCTGTCCTACTACTGTTTCC
TGTGCTGATATACTCGCTATTGCAGCTGAAGAATCCGTTTTTTTG
GCAGGAGGTCCAAATTGGACAGTTCCATTAGGAAGAAGAGATAGTACAACAGCAAGCCGAGATGCAGCAAATGCT
TCCCTTCCAGCCCCTTTTTTAACCCTTGATCAACTCAGAGAGAGCTTCACTAATGTCGGCCTTAATAATAATACTGATTTGGTAGCTCTATCTG
GTGCTCACACATTTGGAAGGGCAAAA
TGTTCTACATTCAACTTCCGATTGTATGATTTCAATGGCACCGGTGCTCCTGACCCAACATTGGACCCGCCTTTTCTAGAAGCTCTTCAGAAATTATGTCCCGAAAATGGAAATGGGAGT
GTGATAACAGATCTTGATGTCACAACAGCTGATGCCTTTGACAATAAGTACTACTCCAATCTGCAAGGTAAGCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCCGGGGCA
GATGATGTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTTTGTGGAGTCCATGATAAGAATGGGAAATATCAGCCCTCTGACAGGAACTGAAGGGGAG
ATCAGATTGAACTGCAGGGTAGTCAATGCAAACCTGGCTGGGCCAGATAGCATGCTTGTTAGCTCAATTTGA

Retrieve as FASTA