Entry information : MePrx126 ( cassava4.1_031287m)
Entry ID 9084
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-03 (Christophe Dunand)
Peroxidase information: MePrx126 ( cassava4.1_031287m)
Name (synonym) MePrx126 ( cassava4.1_031287m)
Class Class III peroxidase    [Orthogroup: Prx065]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx126
start..stop
S start..stop
RcPrx84 518 0 1..321 1..322
RcPrx85 515 0 1..321 1..320
RcPrx80 505 0 1..321 1..321
RcPrx77 503 0 7..321 7..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 409904..410122 219 N° 2 410225..410416 192 N° 3 410619..410784 166 N° 4 410986..411371 386
join(409904..410122,410225..410416,410619..410784,410986..411371)


exon

Literature and cross-references MePrx126 ( cassava4.1_031287m)
DNA ref. Phytozome 12:   scaffold06748 (409904..411371)
Protein sequence: MePrx126 ( cassava4.1_031287m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (295)
PWM (Da):   %s   34081.54 (31230.2)  
PI (pH):   %s   4.71 (4.61) Peptide Signal:   %s   cut: 27 range:27-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSRSSFSCMVLTTVLLIFSSFPCKAQLSSNFYDSTCPNALSTIRSVIDAAVSNEQRMAASLIRLHFHDCFVQGCDGSILLEDTASFTGERTARNNAGSVRGFGVIDDAKAQVESICPGIVSCADILAVAARDSSVAVGGPSWTVNLGRRDSTSASRSLADSDLPAFTDSLDRLISLFGNKNLNARDMVALSGSHTIGQARCLTFRGRIYNNASDIDPDFANTRRSQCPNTGGDGNLAPLDLVTPNTFDNNYYSNLIARRGLLESDQVLFSGGSTDSIVNEYSSDSSAFSSDFASAMVKMGNIDPLTGSQGEIRRICTAV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTCTCGTTCATCTTTTTCTTGCATGGTTTTGACAACAGTCTTATTGATTTTCTCAAGCTTTCCATGTAAAGCTCAACTTTCTTCCAACTTCTATGACAGTACATGTCCTAATGCA
CTCAGTACTATAAGGTCAGTTATTGATGCTGCTGTCTCGAATGAGCAGAGAATGGCTGCTTCACTCATTCGCCTTCACTTCCATGATTGCTTTGTTCAG
GTAGCTAGCTACTTCACAGTT
TCATATATATACACGTTTATTGAGTCTTTTTTTGGCATATTATGTATGTAGAGATTATTGAAACTTTGTTTCTAATTGCAGGGTTGTGATGGGTCAATTTTGCTGGAAGATACAGCGTCG
TTTACTGGAGAAAGAACTGCTCGCAACAATGCTGGTTCCGTCAGAGGATTCGGAGTCATAGATGATGCTAAGGCTCAAGTTGAGAGCATTTGTCCTGGAATTGTATCTTGTGCAGATATT
CTTGCAGTTGCAGCTCGCGATTCATCCGTCGCT
GTAAGCTTCTTCCTCCAACCTTTTTAACCGAACCCGGTCCACAATCGGCCAAAACACCTCCACGCCACAAATAAATGGATTACTTCA
TAAAAAAAGAACGATAAAACTCATTTTAATATCTCTGTGTTGAATAATTTCCCCACAGCTTGAACTTTGTAATTAGGTTATTTGCGTAATGAGTTCTGCGTAATTTTAAACACAGGTTGG
TGGACCATCTTGGACAGTGAATCTTGGAAGAAGAGACTCCACCAGTGCTAGCCGAAGTCTAGCTGACAGCGACCTTCCTGCCTTTACAGACAGCCTAGACAGGCTCATTTCTTTGTTCGG
AAACAAGAATTTAAATGCAAGAGATATGGTTGCTCTTTCAG
GTTTGTGCACAAGAATGAAAGACTAGCTTAGACCTGGTATTCAAAACACATAAATATGTATTATTTTATGAAAAATCAC
ATGAAACCTACGTCCACATCGGGTTGTTTTAGGTTGATTGGTCAAGAATTTACAATTATATTCTACGTACATGCATGCAATTAGAGTAGACTGAGAAGGCTAAAACATTGGAATTCTTAC
AGGATCACATACAATTGGACAAGCTAGATGCCTGACCTTCCGTGGAAGGATTTACAACAACGCAAGTGATATTGATCCTGATTTTGCCAACACAAGAAGAAGCCAATGTCCAAATACTGG
TGGGGATGGAAATCTTGCACCTCTTGATCTGGTGACACCTAATACATTCGACAACAACTACTACTCGAATCTTATTGCAAGAAGAGGACTTCTTGAATCAGACCAGGTGCTTTTCAGTGG
CGGATCTACAGACAGCATTGTTAATGAGTACAGCTCAGACTCTTCAGCTTTCAGTTCTGATTTTGCGTCTGCCATGGTTAAGATGGGTAACATAGACCCACTCACTGGTTCTCAAGGAGA
GATTCGCAGGATTTGCACTGCTGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTCTCGTTCATCTTTTTCTTGCATGGTTTTGACAACAGTCTTATTGATTTTCTCAAGCTTTCCATGTAAAGCTCAACTTTCTTCCAACTTCTATGACAGTACATGTCCTAATGCA
CTCAGTACTATAAGGTCAGTTATTGATGCTGCTGTCTCGAATGAGCAGAGAATGGCTGCTTCACTCATTCGCCTTCACTTCCATGATTGCTTTGTTCAG
GGTTGTGATGGGTCAATTTTG
CTGGAAGATACAGCGTCGTTTACTGGAGAAAGAACTGCTCGCAACAATGCTGGTTCCGTCAGAGGATTCGGAGTCATAGATGATGCTAAGGCTCAAGTTGAGAGCATTTGTCCTGGAATT
GTATCTTGTGCAGATATTCTTGCAGTTGCAGCTCGCGATTCATCCGTCGCT
GTTGGTGGACCATCTTGGACAGTGAATCTTGGAAGAAGAGACTCCACCAGTGCTAGCCGAAGTCTAGCT
GACAGCGACCTTCCTGCCTTTACAGACAGCCTAGACAGGCTCATTTCTTTGTTCGGAAACAAGAATTTAAATGCAAGAGATATGGTTGCTCTTTCAG
GATCACATACAATTGGACAAGCT
AGATGCCTGACCTTCCGTGGAAGGATTTACAACAACGCAAGTGATATTGATCCTGATTTTGCCAACACAAGAAGAAGCCAATGTCCAAATACTGGTGGGGATGGAAATCTTGCACCTCTT
GATCTGGTGACACCTAATACATTCGACAACAACTACTACTCGAATCTTATTGCAAGAAGAGGACTTCTTGAATCAGACCAGGTGCTTTTCAGTGGCGGATCTACAGACAGCATTGTTAAT
GAGTACAGCTCAGACTCTTCAGCTTTCAGTTCTGATTTTGCGTCTGCCATGGTTAAGATGGGTAACATAGACCCACTCACTGGTTCTCAAGGAGAGATTCGCAGGATTTGCACTGCTGTC
AAC

Retrieve as FASTA