Entry information : MePrx128(Manes.06G077600 / cassava4.1_031396m)
Entry ID 9086
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-11-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-08-22 (Christophe Dunand)
Peroxidase information: MePrx128(Manes.06G077600 / cassava4.1_031396m)
Name MePrx128(Manes.06G077600 / cassava4.1_031396m)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx128
start..stop
S start..stop
MePrx12 639 0 1..342 1..340
PtPrx95 577 0 5..342 4..340
PtPrx92 573 0 5..342 4..341
VvPrx48 531 0 3..342 1..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 528275..528520 246 N° 2 527987..528178 192 N° 3 527729..527894 166 N° 4 527229..527650 422
complement(join(527229..527650,527729..527894,527987..528178,528275..528520))


exon

Literature and cross-references MePrx128(Manes.06G077600 / cassava4.1_031396m)
DNA ref. Phytozome 12:   scaffold06656 (528520..527229)
Protein sequence: MePrx128(Manes.06G077600 / cassava4.1_031396m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   342 (311)
PWM (Da):   %s   37045.66 (33648.7)  
PI (pH):   %s   4.91 (4.72) Peptide Signal:   %s   cut: 32 range:32-342
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALAPLLHSKLPSLQLLLLISIFIFCSSLYASDDPPLSLDYYASTCPAVFDIIRKEMECEVLSDPRNAALVVRLHFHDCFVQGCDGSVLLDDTITLQGEKKASPNVNSLIGFSIIDKIKNKVESECPGIVSCADILTIAARDAVILVGGPYWDVPVGRKDSKTASYELASANIPTADEGLVSIISKFLYQGLSVKDMVALSGAHTIGMARCANFRARIYGDFETTSERSPISETYLSNLKSTCPAAGGGDDNVSAMDNVTPNLFDNSYFQILLKGEGLLNSDQELYSSMLGVQTKKLVAKYAHDPVGFFKQFSDSMVKLGNITNPDSFTNGEVRKNCRFVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTGGCACCTCTCCTTCACTCTAAGCTTCCTTCGCTGCAGCTTCTTCTTTTGATTTCTATCTTCATATTCTGCAGCAGCTTGTATGCAAGTGATGACCCTCCTTTGTCATTGGAC
TACTATGCATCTACTTGCCCCGCTGTGTTCGACATTATCAGGAAAGAAATGGAATGTGAAGTTCTTTCAGATCCACGTAATGCAGCTCTTGTAGTCCGACTACATTTCCACGACTGTTTT
GTCCAG
GTCACATCTTACAGCATTTTTTTTCCCTGTGTGTTATTGTCGGAATTATAGTCGAGTGAAGAATAAATATTGTAGTGTATGGTCTAATGGATGCAGGGATGTGATGGTTCAGTT
TTGCTAGATGACACAATCACGTTGCAAGGAGAGAAGAAAGCTTCTCCAAACGTAAACTCCCTGATAGGTTTTAGCATCATTGATAAAATCAAGAACAAGGTGGAATCTGAGTGCCCTGGA
ATCGTTTCCTGCGCTGATATCCTCACTATCGCTGCAAGAGATGCAGTGATTCTG
GTACTATACATCATATAATTGCTATTTCTGATACAATTTTACATTTTTATTCTGAGAAACTTGAGA
TTTTATATTTGCCAATATGCTGTCAGGTTGGTGGACCATATTGGGATGTTCCTGTCGGAAGGAAAGATTCAAAGACTGCAAGTTACGAGCTTGCATCAGCAAATATTCCAACAGCAGATG
AAGGTCTGGTGTCAATCATTTCCAAGTTTCTTTATCAGGGCCTCTCTGTTAAAGACATGGTAGCTCTTTCAG
GTAATAATCTTTTACCGGGACAGTGACCCCTGTTGAATCATGGAATAA
TTACAATAGATGTTTGCATATAATCTGCAGGGGCTCACACTATAGGAATGGCTCGGTGTGCGAACTTTCGAGCAAGGATTTATGGAGACTTCGAAACCACTTCAGAAAGAAGTCCAATCT
CTGAGACATACCTGAGTAACCTGAAATCTACATGTCCAGCTGCCGGAGGAGGAGACGACAACGTATCAGCAATGGATAATGTCACTCCTAACCTTTTCGACAATTCTTACTTTCAGATTC
TATTGAAAGGAGAAGGACTATTGAACTCAGACCAAGAATTGTATTCAAGCATGCTTGGGGTTCAGACAAAGAAGCTTGTAGCGAAGTATGCTCATGACCCAGTTGGTTTTTTCAAGCAAT
TCTCTGATTCTATGGTGAAATTGGGGAACATCACCAATCCTGATAGCTTTACTAATGGAGAAGTCAGGAAGAACTGCAGATTTGTGAACACA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTGGCACCTCTCCTTCACTCTAAGCTTCCTTCGCTGCAGCTTCTTCTTTTGATTTCTATCTTCATATTCTGCAGCAGCTTGTATGCAAGTGATGACCCTCCTTTGTCATTGGAC
TACTATGCATCTACTTGCCCCGCTGTGTTCGACATTATCAGGAAAGAAATGGAATGTGAAGTTCTTTCAGATCCACGTAATGCAGCTCTTGTAGTCCGACTACATTTCCACGACTGTTTT
GTCCAG
GGATGTGATGGTTCAGTTTTGCTAGATGACACAATCACGTTGCAAGGAGAGAAGAAAGCTTCTCCAAACGTAAACTCCCTGATAGGTTTTAGCATCATTGATAAAATCAAGAAC
AAGGTGGAATCTGAGTGCCCTGGAATCGTTTCCTGCGCTGATATCCTCACTATCGCTGCAAGAGATGCAGTGATTCTG
GTTGGTGGACCATATTGGGATGTTCCTGTCGGAAGGAAAGAT
TCAAAGACTGCAAGTTACGAGCTTGCATCAGCAAATATTCCAACAGCAGATGAAGGTCTGGTGTCAATCATTTCCAAGTTTCTTTATCAGGGCCTCTCTGTTAAAGACATGGTAGCTCTT
TCAG
GGGCTCACACTATAGGAATGGCTCGGTGTGCGAACTTTCGAGCAAGGATTTATGGAGACTTCGAAACCACTTCAGAAAGAAGTCCAATCTCTGAGACATACCTGAGTAACCTGAAA
TCTACATGTCCAGCTGCCGGAGGAGGAGACGACAACGTATCAGCAATGGATAATGTCACTCCTAACCTTTTCGACAATTCTTACTTTCAGATTCTATTGAAAGGAGAAGGACTATTGAAC
TCAGACCAAGAATTGTATTCAAGCATGCTTGGGGTTCAGACAAAGAAGCTTGTAGCGAAGTATGCTCATGACCCAGTTGGTTTTTTCAAGCAATTCTCTGATTCTATGGTGAAATTGGGG
AACATCACCAATCCTGATAGCTTTACTAATGGAGAAGTCAGGAAGAACTGCAGATTTGTGAACACA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTCTCTCATT CAAGAAATCC AAGAAAGCAA CAATGGCATT GGCACCTCTC CTTCACTCTA AGCTTCCTTC GCTGCAGCTT CTTCTTTTGA TTTCTATCTT CATATTCTGC AGCAGCTTGT  ATGCAAGTGA TGACCCTCCT TTGTCATTGG ACTACTATGC ATCTACTTGC CCCGCTGTGT TCGACATTAT CAGGAAAGAA ATGGAATGTG AAGTTCTTTC AGATCCACGT AATGCAGCTC  TTGTAGTCCG ACTACATTTC CACGACTGTT TTGTCCAGGG ATGTGATGGT TCAGTTTTGC TAGATGACAC AATCACGTTG CAAGGAGAGA AGAAAGCTTC TCCAAACGTA AACTCCCTGA  TAGGTTTTAG CATCATTGAT AAAATCAAGA ACAAGGTGGA ATCTGAGTGC CCTGGAATCG TTTCCTGCGC TGATATCCTC ACTATCGCTG CAAGAGATGC AGTGATTCTG GTTGGTGGAC  CATATTGGGA TGTTCCTGTC GGAAGGAAAG ATTCAAAGAC TGCAAGTTAC GAGCTTGCAT CAGCAAATAT TCCAACAGCA GATGAAGGTC TGGTGTCAAT CATTTCCAAG TTTCTTTATC  AGGGCCTCTC TGTTAAAGAC ATGGTAGCTC TTTCAGGGGC TCACACTATA GGAATGGCTC GGTGTGCGAA CTTTCGAGCA AGGATTTATG GAGACTTCGA AACCACTTCA GAAAGAAGTC  CAATCTCTGA GACATACCTG AGTAACCTGA AATCTACATG TCCAGCTGCC GGAGGAGGAG ACGACAACGT ATCAGCAATG GATAATGTCA CTCCTAACCT TTTCGACAAT TCTTACTTTC  AGATTCTATT GAAAGGAGAA GGACTATTGA ACTCAGACCA AGAATTGTAT TCAAGCATGC TTGGGGTTCA GACAAAGAAG CTTGTAGCGA AGTATGCTCA TGACCCAGTT GGTTTTTTCA  AGCAATTCTC TGATTCTATG GTGAAATTGG GGAACATCAC CAATCCTGAT AGCTTTACTA ATGGAGAAGT CAGGAAGAAC TGCAGATTTG TGAACACATG AGCTGCCAAA CCATGAAACT  GAATTCTATA ATGAGTTTAT TTATATTTGT TTCTCATACC AAGAAGTGAA AAACACAAAT TTATCTGTAA GAGCTTTTGG ATATTCAAAA ACTTCCCAAA AAAAAAAAGG AAAAAGAAAA 
AGCTATTGGA TGTTGAAGTT GTATTTCCCT TTGATTCAAT TTTGTTCTCT TTTGTTTTCC CCCAAAAAAT TAAATTTAAT AAAATGGATT TGCTAGTAA 

Retrieve as FASTA