Entry information : PtPrx22 (POPTR_0001s04850 / Pxp22 / PT01G01120 / Potri.001G011300)
Entry ID 909
Creation 2010-03-24 (Christophe Dunand)
Last sequence changes 2010-03-24 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx22 (POPTR_0001s04850 / Pxp22 / PT01G01120 / Potri.001G011300)
Name (synonym) PtPrx22 (POPTR_0001s04850 / Pxp22 / PT01G01120 / Potri.001G011300)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type Xylem
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx22
start..stop
S start..stop
PnPrx02 663 0 1..343 1..343
PtPrx33 662 0 1..343 1..343
PatrPrx24 658 0 1..343 1..343
PnPrx01 641 0 1..343 1..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3722494..3722706 213 N° 2 3722207..3722398 192 N° 3 3721804..3721972 169 N° 4 3721257..3721714 458
complement(join(3721257..3721714,3721804..3721972,3722207..3722398,3722494..3722 706))


exon

Literature and cross-references PtPrx22 (POPTR_0001s04850 / Pxp22 / PT01G01120 / Potri.001G011300)
Literature Christensen,J.H., et al. The syringaldazine-oxidizing peroxidase PXP 3-4 from poplar xylem: cDNA isolation, characterization and expression
Plant Mol. Biol. 47 (5), 581-593 (2001).
Protein ref. UniProtKB:   Q43100
DNA ref. Phytozome 12:   scaffold_1 (3722706..3721257)
mRNA ref. GenBank:   X97349
EST ref. GenBank:   CV240318.1 [3' end]
Omic ref. ePlant:   Potri.001G011300
Protein sequence: PtPrx22 (POPTR_0001s04850 / Pxp22 / PT01G01120 / Potri.001G011300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (321)
PWM (Da):   %s   36466.8 (33989.4)  
PI (pH):   %s   4.03 (3.92) Peptide Signal:   %s   cut: 23 range:23-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHFSKAIVEAFFFVVLLRGTLACGQLTPTFYDQTCPNVSSIIRDVITETLVSDPRIGASLIRLHFHDCFVNGCDGSLLLDNTDTIVSEKEAGGNNNSARGFEVVDTMKALLESACPATVSCADILTIAAEESVVLAGGPNWTVPLGRRDSTTASRDAANAFLPAPFFTLDQLRESFTNVSLNNNSDLVALSGAHTFGRAKCSTFDFRLYDFNSTGAPDPSLDTTLLAALQELCPEGGNGSVITDLDLSTPDAFDSDYYSNLQGNRGLLQTDQELFSTPGADDVIALVNAFSANQTAFFESFVESMIRMGNLSPLTGTEGEIRLNCSVVNANLAGPDSMLVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns), 1 mRNA and 1 EST. Sub_species="Trichobel".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTTTCTAAGGCTATAGTTGAAGCTTTTTTCTTTGTAGTTTTGCTTAGAGGAACATTGGCTTGTGGCCAGCTTACTCCAACATTTTATGACCAGACATGTCCAAATGTGAGCAGC
ATTATCCGTGATGTCATTACGGAGACATTGGTATCCGATCCTCGGATTGGAGCCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GTAATTACTTTGAAACATCTTATATTG
CTTATTGCTTAATTTTATTAAACCATCTATCTAAGTTGTGATTCTCAAGTTTTTTATTTTATTTTCAGGGCTGTGATGGTTCGCTTTTGTTGGACAATACTGATACTATAGTGAGCGAAA
AGGAAGCCGGAGGGAACAACAACTCTGCAAGAGGTTTTGAAGTTGTTGATACAATGAAGGCTTTGTTGGAGAGTGCCTGTCCTGCTACTGTTTCCTGTGCTGATATACTCACTATTGCAG
CTGAAGAATCTGTTGTTTTG
GTATCTTAAGATGATCCCTCAACCCCCCAAATCATAAAATAAATCTCTTGTTGTCTTTTTCTAGTCAAAGTACGAAGAACACAAATATCATAGTTTATCA
TAATTGAATGAAAGAAAGAAGCTGAGATTTACTTAATTTTTTACATGACTTTATGAAGGTTTGGACAAAAGGAGTTAAGATAGAAATACGTTAAGAGTTGAAAAGTAGTAATCCCTGACT
ATGCATGGTTGCAGGCAGGAGGTCCAAATTGGACAGTTCCATTAGGAAGAAGAGATAGCACAACAGCAAGCCGAGATGCAGCAAATGCTTTCCTTCCAGCCCCTTTTTTCACCCTTGATC
AACTCAGAGAGAGCTTCACTAATGTCAGCCTTAATAATAATAGTGATTTGGTAGCTCTATCTG
GTAAGTATTATTTGTCAGGCTCAACTCTAAACTGTAAAATCTGTTATCATTGATTCT
CCTTTGATGTAATTTCCTTTTTATCTTCTCAGGTGCTCACACATTTGGCAGGGCAAAATGTTCTACATTCGACTTCCGATTGTATGATTTCAACAGCACCGGTGCTCCTGACCCATCGTT
GGACACAACTCTTCTAGCAGCTCTTCAGGAATTATGTCCCGAAGGTGGAAATGGGAGTGTGATAACAGATCTTGATCTCTCAACACCTGATGCCTTTGACAGTGACTACTACTCCAATCT
GCAAGGTAACCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCGGGGGCAGATGATGTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTT
TGTGGAGTCCATGATAAGAATGGGAAATCTCAGCCCTCTGACAGGAACTGAAGGGGAGATCAGATTGAACTGCAGCGTAGTCAATGCAAACTTGGCTGGGCCAGATAGCATGCTCGTTAG
CTCAATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTTTCTAAGGCTATAGTTGAAGCTTTTTTCTTTGTAGTTTTGCTTAGAGGAACATTGGCTTGTGGCCAGCTTACTCCAACATTTTATGACCAGACATGTCCAAATGTGAGCAGC
ATTATCCGTGATGTCATTACGGAGACATTGGTATCCGATCCTCGGATTGGAGCCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GGCTGTGATGGTTCGCTTTTGTTGGAC
AATACTGATACTATAGTGAGCGAAAAGGAAGCCGGAGGGAACAACAACTCTGCAAGAGGTTTTGAAGTTGTTGATACAATGAAGGCTTTGTTGGAGAGTGCCTGTCCTGCTACTGTTTCC
TGTGCTGATATACTCACTATTGCAGCTGAAGAATCTGTTGTTTTG
GCAGGAGGTCCAAATTGGACAGTTCCATTAGGAAGAAGAGATAGCACAACAGCAAGCCGAGATGCAGCAAATGCT
TTCCTTCCAGCCCCTTTTTTCACCCTTGATCAACTCAGAGAGAGCTTCACTAATGTCAGCCTTAATAATAATAGTGATTTGGTAGCTCTATCTG
GTGCTCACACATTTGGCAGGGCAAAA
TGTTCTACATTCGACTTCCGATTGTATGATTTCAACAGCACCGGTGCTCCTGACCCATCGTTGGACACAACTCTTCTAGCAGCTCTTCAGGAATTATGTCCCGAAGGTGGAAATGGGAGT
GTGATAACAGATCTTGATCTCTCAACACCTGATGCCTTTGACAGTGACTACTACTCCAATCTGCAAGGTAACCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCGGGGGCA
GATGATGTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTTTGTGGAGTCCATGATAAGAATGGGAAATCTCAGCCCTCTGACAGGAACTGAAGGGGAG
ATCAGATTGAACTGCAGCGTAGTCAATGCAAACTTGGCTGGGCCAGATAGCATGCTCGTTAGCTCAATTTGA

Retrieve as FASTA