Entry information : MePrx134 (cassava4.1_032385m)
Entry ID 9091
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-02 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx134 (cassava4.1_032385m)
Name (synonym) MePrx134 (cassava4.1_032385m)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx134
start..stop
S start..stop
RcPrx75 518 0 9..331 5..328
MePrx32 509 0 16..331 5..321
MePrx31 501 1e-180 16..331 5..321
RcPrx54 500 2e-180 14..331 4..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 96785..97204 420 N° 2 97471..97633 163 N° 3 97844..98256 413  
join(96785..97204,97471..97633,97844..98256)


exon

Literature and cross-references MePrx134 (cassava4.1_032385m)
DNA ref. Phytozome 12:   scaffold07873 (96785..98256)
Protein sequence: MePrx134 (cassava4.1_032385m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (300)
PWM (Da):   %s   35546.91 (31993.1) Transmb domain:   %s   i13-35o
PI (pH):   %s   8.01 (8.21) Peptide Signal:   %s   cut: 33 range:33-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIHSSFASSSQTHILILMFIWVLMSGTLVHGQGTRVGFYATSCPRAESIVSTTVARHFRSNAAIAPGLLRMHFHDCFVRGCDASVLIDGSNTEKTAPPNLGLKGFEVIDDAKTQLEAACPGIVSCSDILALAARDSVVLTGGGSWLVPTGRRDGRVTSASETTDLPGFRESIDAQKQKFSAKGLNTQDLVVLVGGHTIGTTACQFFSYRLYNFNSTSTSDPSINPSFLPQLKALCPQNGDGTKRVALDTDSSNRFDATFFDNLRNGRGILESDQKLWTDASTRIVVQRFVGLGGLVAFNAEFGRSMVKMSNIGVKTGSDGEIRKICSAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATACACTCTAGCTTTGCTTCTTCAAGCCAAACCCACATTTTAATATTAATGTTCATCTGGGTTTTAATGTCTGGGACCTTAGTGCATGGCCAAGGGACTCGTGTTGGATTCTAT
GCTACATCATGTCCTAGAGCTGAATCCATTGTAAGCACAACGGTTGCTAGGCATTTTCGATCTAATGCAGCCATTGCTCCTGGTTTGCTGAGGATGCATTTCCATGATTGCTTTGTACGA
GGATGTGATGCTTCTGTCCTTATTGATGGTTCCAATACTGAGAAAACTGCACCACCAAATCTTGGGTTGAAAGGCTTTGAAGTTATTGACGATGCCAAAACTCAGCTTGAAGCTGCATGT
CCTGGAATTGTTTCTTGCTCTGATATTCTTGCACTTGCTGCCCGTGACTCTGTCGTTCTG
GTAATCATCACATCCAATAATTACCGTAAAAGTTATTATACACACGTCACTACTAAAACA
CTACTGATAATTCGTATTTAACTTCATATATTTTTTAAAATTCTTAACGGTATATAAAGCATGAAGTAAATATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTAAAGGTAGCTTCTTTTAAATTTCATGCAGACTGGAGGAGGAAGTTGGCTGGTGCCCACTGGAC
GTAGAGACGGCCGAGTGACATCAGCATCTGAAACAACAGATTTGCCTGGCTTCAGAGAATCCATTGATGCCCAAAAGCAAAAGTTCTCTGCAAAAGGTCTCAACACACAAGACCTTGTTG
TACTTGTCG
GTAAGCTTTAAATACTTCCCGGACCGTCCACCATGAATCAAAACACTGATAAATGAGTTTGTAAAAGAAAAAAATAATAGATGTGACGACTTGAATATCTGTTGATCTATG
GAGAACCGGATCTTCTTAAAAACTTACGTAGGCTACTCTCATTTTACACTATGAATCAATATGGACCTGACAATAATTTTGCGTCTTGTAATACTACAGGAGGCCACACCATAGGAACAA
CAGCTTGCCAGTTCTTTAGTTACAGATTATACAACTTCAACTCCACCTCAACTTCTGATCCTTCCATTAACCCTTCATTTCTTCCTCAACTAAAAGCACTGTGTCCACAGAATGGAGATG
GAACAAAGAGAGTTGCTTTAGACACAGACAGTTCAAACAGATTTGATGCAACTTTCTTCGACAACCTCAGAAATGGCCGAGGAATACTTGAGTCTGATCAGAAACTGTGGACTGATGCTT
CTACAAGAATCGTTGTTCAACGATTCGTGGGTCTTGGTGGTTTGGTTGCATTCAATGCTGAGTTTGGAAGGTCCATGGTTAAGATGAGTAATATTGGAGTGAAGACAGGCAGTGATGGTG
AAATTAGAAAAATATGTTCTGCAATAAACTCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATACACTCTAGCTTTGCTTCTTCAAGCCAAACCCACATTTTAATATTAATGTTCATCTGGGTTTTAATGTCTGGGACCTTAGTGCATGGCCAAGGGACTCGTGTTGGATTCTAT
GCTACATCATGTCCTAGAGCTGAATCCATTGTAAGCACAACGGTTGCTAGGCATTTTCGATCTAATGCAGCCATTGCTCCTGGTTTGCTGAGGATGCATTTCCATGATTGCTTTGTACGA
GGATGTGATGCTTCTGTCCTTATTGATGGTTCCAATACTGAGAAAACTGCACCACCAAATCTTGGGTTGAAAGGCTTTGAAGTTATTGACGATGCCAAAACTCAGCTTGAAGCTGCATGT
CCTGGAATTGTTTCTTGCTCTGATATTCTTGCACTTGCTGCCCGTGACTCTGTCGTTCTG
ACTGGAGGAGGAAGTTGGCTGGTGCCCACTGGACGTAGAGACGGCCGAGTGACATCAGCA
TCTGAAACAACAGATTTGCCTGGCTTCAGAGAATCCATTGATGCCCAAAAGCAAAAGTTCTCTGCAAAAGGTCTCAACACACAAGACCTTGTTGTACTTGTCG
GAGGCCACACCATAGGA
ACAACAGCTTGCCAGTTCTTTAGTTACAGATTATACAACTTCAACTCCACCTCAACTTCTGATCCTTCCATTAACCCTTCATTTCTTCCTCAACTAAAAGCACTGTGTCCACAGAATGGA
GATGGAACAAAGAGAGTTGCTTTAGACACAGACAGTTCAAACAGATTTGATGCAACTTTCTTCGACAACCTCAGAAATGGCCGAGGAATACTTGAGTCTGATCAGAAACTGTGGACTGAT
GCTTCTACAAGAATCGTTGTTCAACGATTCGTGGGTCTTGGTGGTTTGGTTGCATTCAATGCTGAGTTTGGAAGGTCCATGGTTAAGATGAGTAATATTGGAGTGAAGACAGGCAGTGAT
GGTGAAATTAGAAAAATATGTTCTGCAATAAACTCA

Retrieve as FASTA