Entry information : MePrx32 (cassava4.1_011950m)
Entry ID 9111
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx32 (cassava4.1_011950m)
Name (synonym) MePrx32 (cassava4.1_011950m)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx32
start..stop
S start..stop
RcPrx75 540 0 2..321 7..328
MePrx31 527 0 1..321 1..321
RcPrx54 523 0 1..321 3..324
MePrx134 509 0 5..321 16..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37386..37772 387 N° 2 37858..38020 163 N° 3 38123..38535 413  
join(37386..37772,37858..38020,38123..38535)


exon

Literature and cross-references MePrx32 (cassava4.1_011950m)
DNA ref. Phytozome 12:   scaffold04233 (37386..38535)
Protein sequence: MePrx32 (cassava4.1_011950m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (300)
PWM (Da):   %s   34374.6 (32128.4)  
PI (pH):   %s   9.03 (9.15) Peptide Signal:   %s   cut: 22 range:22-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRCIMLICLFVALLATLVQGQRTRVGFYSRTCPTAESIVKSTVDTHFKSNPAVAAGLLRMHFHDCFVQGCDASILIDGSNTEKTALPNLGLKGFEVIDDAKTQLEAACPGIVSCADILALAARDSVVLTGGRSWRVPTGRRDGRVSLVSDTANLPGFTDSIDKQKQKFAEKGLNAQDLVALVGGHTIGTTACQFFNYRLYNASGNGSDPTINASFLPQLQALCPQNGDGTKRVALDTGSVNKFDVSFFSNLRNGRGILESDQKLWTDASTRTLVQRFMGVRGLAALKFNVEFGKSMVKMSNIGVKTGSDGEIRKKCSVI

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGATGCATTATGTTAATATGTCTCTTTGTTGCTTTGCTTGCGACGTTGGTGCAAGGCCAACGCACTCGTGTTGGATTCTATTCTCGTACTTGTCCTACAGCTGAATCTATTGTA
AAGTCTACAGTTGATACACATTTTAAGTCTAACCCAGCAGTTGCTGCTGGTTTGCTTAGGATGCATTTCCATGATTGCTTTGTTCAAGGATGTGATGCTTCTATTCTTATTGATGGTTCC
AACACTGAGAAAACTGCACTACCAAATCTTGGATTGAAAGGCTTTGAAGTTATTGATGATGCCAAGACTCAGCTTGAAGCTGCATGTCCTGGAATTGTTTCTTGCGCTGATATTCTTGCA
CTTGCAGCTCGTGACTCTGTTGTTCTG
GTAATTATTGATCACATTTAATGAGTTGATAATTCAGAAAATTACTATAAACTGCTAAACGTTTGCGTCTTTAAATTTCATGCAGACTGGTGG
AAGAAGTTGGAGGGTGCCTACTGGACGTAGAGACGGTCGGGTGTCATTGGTATCTGATACTGCTAATTTGCCTGGCTTCACAGACTCCATAGACAAACAAAAGCAAAAGTTCGCTGAAAA
GGGTCTTAATGCACAGGATCTTGTCGCTCTAGTTG
GTAACTACAGAAACCCATCTGAATTTTTCATGTTTATTTAGTATTAAGACACAAAATTCAACGATAATTAACTTCCATGTCCATG
GTTTTTTGTTGATATAGGAGGACACACAATAGGGACTACAGCTTGCCAATTCTTTAATTATAGACTTTATAATGCAAGCGGGAACGGATCCGACCCAACAATCAACGCCTCATTTCTTCC
CCAGCTACAAGCACTGTGTCCACAGAACGGCGACGGGACAAAGCGAGTCGCATTAGATACAGGCAGCGTGAACAAGTTTGATGTATCTTTCTTCAGCAACCTGAGAAATGGGCGAGGCAT
TCTTGAGTCCGATCAGAAATTGTGGACAGATGCTTCCACCAGAACCTTGGTTCAACGATTCATGGGTGTTAGAGGCTTGGCTGCATTGAAGTTCAATGTTGAGTTCGGGAAGTCCATGGT
GAAGATGAGTAACATTGGAGTGAAGACAGGATCTGATGGTGAAATTAGGAAAAAATGTTCTGTAATAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGATGCATTATGTTAATATGTCTCTTTGTTGCTTTGCTTGCGACGTTGGTGCAAGGCCAACGCACTCGTGTTGGATTCTATTCTCGTACTTGTCCTACAGCTGAATCTATTGTA
AAGTCTACAGTTGATACACATTTTAAGTCTAACCCAGCAGTTGCTGCTGGTTTGCTTAGGATGCATTTCCATGATTGCTTTGTTCAAGGATGTGATGCTTCTATTCTTATTGATGGTTCC
AACACTGAGAAAACTGCACTACCAAATCTTGGATTGAAAGGCTTTGAAGTTATTGATGATGCCAAGACTCAGCTTGAAGCTGCATGTCCTGGAATTGTTTCTTGCGCTGATATTCTTGCA
CTTGCAGCTCGTGACTCTGTTGTTCTG
ACTGGTGGAAGAAGTTGGAGGGTGCCTACTGGACGTAGAGACGGTCGGGTGTCATTGGTATCTGATACTGCTAATTTGCCTGGCTTCACAGAC
TCCATAGACAAACAAAAGCAAAAGTTCGCTGAAAAGGGTCTTAATGCACAGGATCTTGTCGCTCTAGTTG
GAGGACACACAATAGGGACTACAGCTTGCCAATTCTTTAATTATAGACTT
TATAATGCAAGCGGGAACGGATCCGACCCAACAATCAACGCCTCATTTCTTCCCCAGCTACAAGCACTGTGTCCACAGAACGGCGACGGGACAAAGCGAGTCGCATTAGATACAGGCAGC
GTGAACAAGTTTGATGTATCTTTCTTCAGCAACCTGAGAAATGGGCGAGGCATTCTTGAGTCCGATCAGAAATTGTGGACAGATGCTTCCACCAGAACCTTGGTTCAACGATTCATGGGT
GTTAGAGGCTTGGCTGCATTGAAGTTCAATGTTGAGTTCGGGAAGTCCATGGTGAAGATGAGTAACATTGGAGTGAAGACAGGATCTGATGGTGAAATTAGGAAAAAATGTTCTGTAATA
AAT

Retrieve as FASTA