Entry information : MePrx60 (cassava4.1_021806m)
Entry ID 9119
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-25 (Christophe Dunand)
Peroxidase information: MePrx60 (cassava4.1_021806m)
Name (synonym) MePrx60 (cassava4.1_021806m)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx60
start..stop
S start..stop
MePrx11 560 0 1..329 1..329
RcPrx21 555 0 1..329 3..334
EglPrx134 545 0 1..329 1..329
EguPrx134 545 0 1..329 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 182709..182924 216 N° 2 183000..183200 201 N° 3 183284..183449 166 N° 4 183588..183991 404
join(182709..182924,183000..183200,183284..183449,183588..183991)


exon

Literature and cross-references MePrx60 (cassava4.1_021806m)
DNA ref. Phytozome 12:   scaffold03363 (182709..183991)
Protein sequence: MePrx60 (cassava4.1_021806m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   35943.26 (33261.9)  
PI (pH):   %s   9.15 (9.45) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGCFQLIFVLSLSFSLCLFSSTVSAQLRQNYYAKVCPDVESIVRNAVQKKFKETFVTAPATIRLFFHDCFVQGCDASVIVQSTPTNKAEKDYPDNLSLAGDGFDTVIKAKEAVDAVPSCRNKVSCADILAMATRDVIALSGGPSYGVELGRLDGLSSTAASVHGKLPHETFNLNQLISLFAANGLSQTDMIALSAAHTVGFSHCSKFSNRLYNFSRQNPVDPTLNKAYATQLRQMCPRKVDPRIAINIDPTTPNTFDNVYFQNLQRGHGLFTSDQVLFTDPRSRPTVNAWASNSMAFQKAFVAAITRLGRVRVKTGRNGNIRRDCAIL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTGTTTCCAGCTTATTTTTGTATTGTCACTTTCTTTCAGTTTGTGCCTCTTCTCTAGTACTGTATCAGCTCAGCTCAGACAAAACTATTATGCCAAAGTTTGCCCAGATGTGGAA
TCCATTGTCAGAAATGCAGTTCAAAAAAAATTTAAAGAGACTTTTGTCACTGCTCCTGCTACCATCCGTCTCTTCTTCCATGATTGCTTTGTGCAG
GTATATAATACCCATTAATCCATT
TTAGCTTATACAAAAATTGGTTTCTGATTGTATACTTAAATATTATGAAAGGGATGTGACGCTTCAGTTATAGTTCAATCCACTCCAACCAACAAAGCAGAGAAGGATTACCCTGATAAT
CTATCGTTGGCCGGAGATGGATTTGACACCGTGATCAAGGCCAAAGAAGCGGTGGATGCCGTCCCCAGCTGCAGAAACAAGGTTTCATGTGCGGATATTCTTGCCATGGCAACAAGAGAT
GTTATTGCTCTG
GTGAGTCCATCAATTTGTTGGTGACAATTGAACGTACAGTGTCTAATTTTGTGGTGTGCATGTTCAATATTAAATGAAAACAGTCTGGTGGACCTTCATATGGTGTTG
AATTGGGAAGACTGGATGGCCTCAGCTCAACTGCTGCTAGTGTTCATGGGAAGCTGCCTCATGAAACTTTCAATCTCAATCAGCTCATTTCTCTTTTTGCTGCTAACGGCCTCTCCCAAA
CTGACATGATTGCTCTATCAG
GTACCCATTAATTCTTATCATTGCTGTTGTTAGTTTCAACGATATTCAAATTATTTTTTTCACAATAAAGCTGAAAAGCCAAAAGGAATTAAAGAAGGC
AAGCTTTATAATTGGCCAAAATGACTATATTTTCTGCAGCGGCACACACAGTTGGATTCTCCCACTGCAGCAAGTTCAGCAACAGACTATACAATTTCAGTCGTCAAAATCCAGTGGATC
CTACACTCAACAAGGCCTATGCAACTCAGCTACGGCAGATGTGCCCCAGAAAGGTTGATCCCAGGATAGCCATCAACATCGACCCGACCACACCCAACACCTTTGACAACGTGTACTTTC
AGAACCTCCAGAGAGGACATGGCCTCTTCACCTCCGACCAAGTCCTCTTTACAGACCCAAGATCCAGACCCACTGTTAATGCATGGGCCTCCAACTCCATGGCCTTTCAGAAAGCCTTTG
TCGCTGCAATCACGAGGTTGGGCCGGGTCAGAGTCAAGACCGGTAGAAACGGTAATATTCGTCGAGATTGTGCCATTTTAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTGTTTCCAGCTTATTTTTGTATTGTCACTTTCTTTCAGTTTGTGCCTCTTCTCTAGTACTGTATCAGCTCAGCTCAGACAAAACTATTATGCCAAAGTTTGCCCAGATGTGGAA
TCCATTGTCAGAAATGCAGTTCAAAAAAAATTTAAAGAGACTTTTGTCACTGCTCCTGCTACCATCCGTCTCTTCTTCCATGATTGCTTTGTGCAG
GGATGTGACGCTTCAGTTATAGTT
CAATCCACTCCAACCAACAAAGCAGAGAAGGATTACCCTGATAATCTATCGTTGGCCGGAGATGGATTTGACACCGTGATCAAGGCCAAAGAAGCGGTGGATGCCGTCCCCAGCTGCAGA
AACAAGGTTTCATGTGCGGATATTCTTGCCATGGCAACAAGAGATGTTATTGCTCTG
TCTGGTGGACCTTCATATGGTGTTGAATTGGGAAGACTGGATGGCCTCAGCTCAACTGCTGCT
AGTGTTCATGGGAAGCTGCCTCATGAAACTTTCAATCTCAATCAGCTCATTTCTCTTTTTGCTGCTAACGGCCTCTCCCAAACTGACATGATTGCTCTATCAG
CGGCACACACAGTTGGA
TTCTCCCACTGCAGCAAGTTCAGCAACAGACTATACAATTTCAGTCGTCAAAATCCAGTGGATCCTACACTCAACAAGGCCTATGCAACTCAGCTACGGCAGATGTGCCCCAGAAAGGTT
GATCCCAGGATAGCCATCAACATCGACCCGACCACACCCAACACCTTTGACAACGTGTACTTTCAGAACCTCCAGAGAGGACATGGCCTCTTCACCTCCGACCAAGTCCTCTTTACAGAC
CCAAGATCCAGACCCACTGTTAATGCATGGGCCTCCAACTCCATGGCCTTTCAGAAAGCCTTTGTCGCTGCAATCACGAGGTTGGGCCGGGTCAGAGTCAAGACCGGTAGAAACGGTAAT
ATTCGTCGAGATTGTGCCATTTTAAAT

Retrieve as FASTA