Entry information : MePrx67 (cassava4.1_022772m)
Entry ID 9124
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx67 (cassava4.1_022772m)
Name (synonym) MePrx67 (cassava4.1_022772m)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx67
start..stop
S start..stop
MePrx69 640 0 1..323 1..322
MePrx76 628 0 3..324 2..324
MePrx28 508 0 12..323 15..325
RcPrx35 506 0 10..324 15..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 250897..251121 225 N° 2 251201..251392 192 N° 3 251481..251646 166 N° 4 251758..252146 389
join(250897..251121,251201..251392,251481..251646,251758..252146)


exon

Literature and cross-references MePrx67 (cassava4.1_022772m)
DNA ref. Phytozome 12:   scaffold10173 (250897..252146)
Protein sequence: MePrx67 (cassava4.1_022772m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (296)
PWM (Da):   %s   35214.16 (32191.6) Transmb domain:   %s   i9-28o
PI (pH):   %s   9.89 (9.79) Peptide Signal:   %s   cut: 29 range:29-324
Sequence 365
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATNSIRKISGAVMFMVIFLVLNIACQAKLNSKYYEKSCPKALSTIRSTIRTAIARERRMAASLIRLHFHDCFVQGCDGSILLDETSSIKSEKTALPNLNSARGFEVIEKAKSEVEKICPGVVSCADIIAVAARDATEYVAGPSYTVLLGRRDSITASRDRANKELPSFKDGLNKLISRFQKIGLNARDLVALSGSHTLGQAQCATFRDRIYSNGSDIDAGFATTRRRHCPAVGSDGNLAPLDLVTPNSWDSNYFKNLIQKKGLLESDQVLFSGGSTDSIVREYSKNRAAFNADFASAMIKMGNYKPLTGSKGQIRRICSAVNK

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAACTAATTCTATTCGAAAAATCTCAGGAGCTGTCATGTTCATGGTTATATTTCTTGTCTTGAATATCGCATGCCAAGCTAAACTCAACTCTAAGTATTATGAAAAATCATGTCCAA
AAGCTCTCAGTACTATCAGAAGTACCATTAGGACTGCTATTGCACGAGAACGAAGAATGGCAGCATCTCTCATTCGTCTGCACTTTCATGATTGTTTTGTCCAG
GTACTAAATATTGATT
ATTACTTAATTATAGTCCTAAATATTCATGTTTTGTTGAAAATTAAATCCTCTTCTTTTGCAGGGTTGTGATGGCTCAATCCTACTGGATGAGACTTCCTCTATCAAGAGTGAAAAGACT
GCATTGCCTAACTTAAATTCTGCTAGAGGTTTTGAAGTCATTGAGAAGGCAAAATCTGAAGTGGAGAAGATTTGCCCTGGTGTTGTTTCCTGTGCAGATATCATTGCAGTGGCTGCAAGG
GATGCTACTGAATAT
GTAAGTAATACCAATATGTCTTCTCAATTCATGTCCATCGAGAAACCCAGGAACCAGACTAATTTATCGTATATTTTCAAAATCTCAGGTGGCTGGTCCATCTTA
TACGGTCTTGCTTGGAAGAAGAGATTCAATTACTGCAAGCAGAGATCGAGCCAACAAAGAACTTCCTAGTTTTAAAGATGGCCTGAACAAACTTATATCTCGCTTTCAGAAAATAGGACT
CAATGCTAGAGACTTGGTTGCTTTGTCAG
GTTCAAACCATTCCAACCCTTAATTCCTTACAGTCATTAATAAATTATAGCATAACTCATCTTTAGCTTTATTTTCTTAAATGCTAAATAT
ATCCATTGCTCCAAACGCAGGTTCTCACACTCTAGGACAAGCTCAATGTGCTACATTTCGTGATAGGATATACAGCAACGGCAGTGATATTGATGCTGGATTTGCTACCACTCGCCGTCG
TCATTGTCCTGCCGTTGGTAGTGATGGAAATTTGGCTCCACTTGATTTGGTCACACCCAATTCTTGGGATAGCAACTACTTCAAGAATTTGATCCAAAAGAAAGGTCTTCTGGAATCAGA
TCAAGTTCTCTTTAGTGGAGGTTCCACCGATAGTATTGTCCGAGAATACAGCAAAAATCGTGCAGCTTTTAATGCAGATTTTGCATCTGCCATGATCAAGATGGGAAATTATAAGCCTCT
TACTGGTTCTAAAGGACAGATCAGGAGAATTTGCAGTGCCGTCAACAAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAACTAATTCTATTCGAAAAATCTCAGGAGCTGTCATGTTCATGGTTATATTTCTTGTCTTGAATATCGCATGCCAAGCTAAACTCAACTCTAAGTATTATGAAAAATCATGTCCAA
AAGCTCTCAGTACTATCAGAAGTACCATTAGGACTGCTATTGCACGAGAACGAAGAATGGCAGCATCTCTCATTCGTCTGCACTTTCATGATTGTTTTGTCCAG
GGTTGTGATGGCTCAA
TCCTACTGGATGAGACTTCCTCTATCAAGAGTGAAAAGACTGCATTGCCTAACTTAAATTCTGCTAGAGGTTTTGAAGTCATTGAGAAGGCAAAATCTGAAGTGGAGAAGATTTGCCCTG
GTGTTGTTTCCTGTGCAGATATCATTGCAGTGGCTGCAAGGGATGCTACTGAATAT
GTGGCTGGTCCATCTTATACGGTCTTGCTTGGAAGAAGAGATTCAATTACTGCAAGCAGAGATC
GAGCCAACAAAGAACTTCCTAGTTTTAAAGATGGCCTGAACAAACTTATATCTCGCTTTCAGAAAATAGGACTCAATGCTAGAGACTTGGTTGCTTTGTCAG
GTTCTCACACTCTAGGAC
AAGCTCAATGTGCTACATTTCGTGATAGGATATACAGCAACGGCAGTGATATTGATGCTGGATTTGCTACCACTCGCCGTCGTCATTGTCCTGCCGTTGGTAGTGATGGAAATTTGGCTC
CACTTGATTTGGTCACACCCAATTCTTGGGATAGCAACTACTTCAAGAATTTGATCCAAAAGAAAGGTCTTCTGGAATCAGATCAAGTTCTCTTTAGTGGAGGTTCCACCGATAGTATTG
TCCGAGAATACAGCAAAAATCGTGCAGCTTTTAATGCAGATTTTGCATCTGCCATGATCAAGATGGGAAATTATAAGCCTCTTACTGGTTCTAAAGGACAGATCAGGAGAATTTGCAGTG
CCGTCAACAAA

Retrieve as FASTA