Entry information : MePrx68 (cassava4.1_022946m)
Entry ID 9125
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx68 (cassava4.1_022946m)
Name (synonym) MePrx68 (cassava4.1_022946m)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx68
start..stop
S start..stop
RcPrx68 525 0 21..325 21..325
PtPrx88 508 0 1..325 1..323
LuPrx179 456 1e-162 1..325 1..325
LuPrx213 453 7e-162 14..325 13..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 770376..770603 228 N° 2 770964..771143 180 N° 3 771225..771384 160 N° 4 771463..771869 407
join(770376..770603,770964..771143,771225..771384,771463..771869)


exon

Literature and cross-references MePrx68 (cassava4.1_022946m)
DNA ref. Phytozome 12:   scaffold01701 (770376..771869)
Protein sequence: MePrx68 (cassava4.1_022946m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325
PWM (Da):   %s   34377.77 Transmb domain:   %s   i7-29o
PI (pH):   %s   6.29
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKVKPTLLLLALGVGLILGILAGCCHGSLQVGFYVGKCGFADVEALVAGVISAHFLRDPTIVAALLRLQFHDCFVNGCDGSILIDGINSEKTAPPNLSVRGYDIIDEAKAVVDNACPGVVSCADLIAIATRDAVFLSGGGRYEVETGRRDGLVSIAQNVSILGPKISVPDAIAAFADKGLSATDMVLLLGAHSVGVAHCSLIKHRLYNFQGTGNHDPAMDPFLVNILRSRCPQISPIDNTVNLDQNPLSPFLMDVSYYQNIMLHRGILQIDQQLGMDPLTMPIVRNLASEFDFPTRFGAAMVKLGAIGVLTGTQGEIRTSCRAT

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGTCAAGCCGACACTTCTGCTGCTGGCCCTTGGGGTTGGGCTCATTTTAGGAATCTTGGCAGGCTGTTGCCATGGCTCTCTGCAGGTAGGGTTTTACGTTGGCAAATGCGGATTT
GCAGATGTTGAGGCTCTAGTGGCTGGCGTTATCAGTGCACATTTCTTAAGAGACCCTACAATCGTTGCCGCCCTCTTACGCTTGCAGTTCCATGATTGCTTTGTTAAT
GTAAGTTTATGC
TTCTATTCTACATGCATTTTTTAAAAAGATCTAATAACAATTGAAAAAAAAAAAAAAGAAGAAACTTCAAGCATGTTTGCTCATAACAATTAAAGGCTAAGCATTCATGAACCAGGAATA
ATCCCATGTGGCAAGAATCGTGGATGATGTAGTGGTTGGTAAGCAAGCTTTGTGTGCACTTACTTCACTTCTCTCAAGTACAAGCTCATGTGTTTTGTTTGGTTTTAAGTGCACATGCAT
GAGCCCATTTTCTAAAAATTCTAATAATTAGTGTACCCAAATAACAGCATGTCATTTTTTTTTCCTCAAAAAATTGTTAATTGACTGGCCATTTGATTGTGGAAATAGGGGTGTGATGGA
TCCATACTTATAGATGGAATCAATAGTGAGAAAACAGCACCGCCAAATCTGAGCGTTAGGGGATATGACATTATCGACGAAGCAAAGGCTGTTGTGGACAACGCATGCCCTGGCGTCGTC
TCTTGTGCTGATCTCATTGCAATAGCTACTAGAGATGCTGTTTTCTTG
GTATCCCCTCTCTCTGTGTTGAAAAATTTATATCATCTAGAATCAGTAGTTATCTGATGGTATGCGTTGATT
TAATTACAGAGTGGTGGAGGAAGATACGAAGTTGAAACAGGAAGAAGGGATGGTTTAGTTTCCATAGCTCAAAATGTGAGTATCCTAGGCCCTAAAATATCAGTTCCTGACGCCATTGCA
GCGTTTGCTGATAAAGGGCTCAGTGCTACAGACATGGTGCTCCTTTTAG
GTAACTACAAAATTTCCCACTAATCCAAGACTTCATTTCTTATATTCCAATCCCTTTTATGCAATTGGCGG
AATGCAGGTGCCCATTCTGTTGGAGTTGCTCATTGTTCCCTCATCAAACACCGTCTCTACAATTTTCAAGGCACTGGCAATCATGATCCAGCTATGGATCCTTTCCTAGTTAACATCTTG
AGATCAAGGTGTCCTCAGATTTCCCCTATAGACAACACAGTTAATCTTGATCAAAATCCACTTAGTCCCTTTTTAATGGATGTCTCCTACTATCAGAATATAATGCTGCACAGAGGCATT
CTCCAAATTGATCAACAGCTGGGAATGGACCCTTTGACTATGCCCATAGTGAGAAATCTAGCTTCAGAATTTGATTTCCCTACCAGGTTTGGCGCTGCCATGGTTAAATTAGGCGCTATA
GGAGTTCTTACTGGCACACAAGGAGAGATTAGGACATCATGTAGAGCTACTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGTCAAGCCGACACTTCTGCTGCTGGCCCTTGGGGTTGGGCTCATTTTAGGAATCTTGGCAGGCTGTTGCCATGGCTCTCTGCAGGTAGGGTTTTACGTTGGCAAATGCGGATTT
GCAGATGTTGAGGCTCTAGTGGCTGGCGTTATCAGTGCACATTTCTTAAGAGACCCTACAATCGTTGCCGCCCTCTTACGCTTGCAGTTCCATGATTGCTTTGTTAAT
GGGTGTGATGGA
TCCATACTTATAGATGGAATCAATAGTGAGAAAACAGCACCGCCAAATCTGAGCGTTAGGGGATATGACATTATCGACGAAGCAAAGGCTGTTGTGGACAACGCATGCCCTGGCGTCGTC
TCTTGTGCTGATCTCATTGCAATAGCTACTAGAGATGCTGTTTTCTTG
AGTGGTGGAGGAAGATACGAAGTTGAAACAGGAAGAAGGGATGGTTTAGTTTCCATAGCTCAAAATGTGAGT
ATCCTAGGCCCTAAAATATCAGTTCCTGACGCCATTGCAGCGTTTGCTGATAAAGGGCTCAGTGCTACAGACATGGTGCTCCTTTTAG
GTGCCCATTCTGTTGGAGTTGCTCATTGTTCC
CTCATCAAACACCGTCTCTACAATTTTCAAGGCACTGGCAATCATGATCCAGCTATGGATCCTTTCCTAGTTAACATCTTGAGATCAAGGTGTCCTCAGATTTCCCCTATAGACAACACA
GTTAATCTTGATCAAAATCCACTTAGTCCCTTTTTAATGGATGTCTCCTACTATCAGAATATAATGCTGCACAGAGGCATTCTCCAAATTGATCAACAGCTGGGAATGGACCCTTTGACT
ATGCCCATAGTGAGAAATCTAGCTTCAGAATTTGATTTCCCTACCAGGTTTGGCGCTGCCATGGTTAAATTAGGCGCTATAGGAGTTCTTACTGGCACACAAGGAGAGATTAGGACATCA
TGTAGAGCTACTAAT

Retrieve as FASTA