Entry information : MePrx76 (cassava4.1_024245m)
Entry ID 9132
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx76 (cassava4.1_024245m)
Name (synonym) MePrx76 (cassava4.1_024245m)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx76
start..stop
S start..stop
MePrx69 634 0 1..323 1..322
MePrx67 628 0 2..324 3..324
MePrx28 513 0 1..323 1..325
RcPrx35 510 0 1..324 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 257597..257821 225 N° 2 257918..258109 192 N° 3 258197..258362 166 N° 4 258480..258868 389
join(257597..257821,257918..258109,258197..258362,258480..258868)


exon

Literature and cross-references MePrx76 (cassava4.1_024245m)
DNA ref. Phytozome 12:   scaffold10173 (257597..258868)
Protein sequence: MePrx76 (cassava4.1_024245m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (296)
PWM (Da):   %s   35182.16 (32168.6)  
PI (pH):   %s   10.02 (9.94) Peptide Signal:   %s   cut: 29 range:29-324
Sequence 365
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTSVRKISGAFMFTVMVLVLLNTACQAKLNSKYYEKSCPKALVTIRSTIRTAIARERRMAASLIRLHFHDCFVQGCDASILLDETSSIKSEKTALPNLNSARGFEVIEKAKSEVEKICPGVVSCADIIAVAARDATEHVAGPSYTVLLGRRDSTTASRDRANKELPSFRDGLNKLISRFQKVGLNARDLVALSGSHTLGQAQCATFRDRIYSNGSDIDAGFATTRRRRCPAVGGDGNLAPLDLVTPNSWDTNYFKNLIQKKGLLESDQVLFSGGSTDSIVKEYSKNRAAFNADFASAMIKMGNYKPLTGSKGQIRRICSAVNK

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACAACTTCAGTTCGAAAAATCTCAGGAGCTTTCATGTTCACTGTCATGGTTTTGGTGTTATTGAACACCGCATGTCAAGCTAAACTCAACTCTAAGTATTATGAGAAATCATGTCCAA
AAGCTCTCGTTACTATCAGAAGTACCATCAGGACGGCTATTGCACGAGAACGAAGAATGGCAGCATCTCTCATTCGTCTGCACTTTCATGATTGTTTTGTCCAG
GTACTTAATTAATGTT
TATTACTATATATTTATAATCTTAGGCTTTCAAGTTTAAGTCCTTGGAAATTAAAATTATCCTTTTTTTTTTTTTTGCAGGGTTGTGATGCTTCAATCCTACTGGACGAGACGTCCTCTA
TCAAGAGTGAAAAGACTGCATTGCCCAACTTAAATTCTGCAAGAGGATTTGAAGTCATTGAAAAGGCAAAATCTGAAGTGGAGAAGATATGCCCAGGTGTTGTATCCTGTGCAGATATCA
TTGCTGTGGCTGCAAGGGATGCTACTGAACAT
GTAAGTAATTAGTCCCAATATGTCTTCTCAATTCATGTCTATTGATAAAAACCTGGAGCCAAAACTAATGTGTTATTTAAATATCAGG
TCGCTGGTCCATCTTACACTGTGTTGCTCGGAAGAAGAGATTCAACTACTGCAAGCAGGGATCGAGCCAACAAGGAACTTCCTAGTTTTAGAGATGGCCTGAACAAACTTATATCTCGCT
TTCAGAAAGTGGGACTCAATGCTAGGGACTTGGTTGCTTTGTCAG
GTTCGAACCATTCTAATTAAAATTAATTAATCCTTAATTACTTAGGTCATTAATTAGCATAACGCATCTTTATTT
TTATTCTCTTAATGCTAAACGTATCCATTTCTCCAAACGCAGGTTCTCATACTCTAGGACAAGCTCAGTGTGCAACATTTCGTGATAGGATATACAGCAATGGCAGTGACATTGATGCTG
GATTTGCTACCACTCGCCGGCGTCGTTGTCCTGCTGTTGGAGGCGATGGAAATTTAGCTCCACTTGATCTGGTCACACCCAATTCTTGGGACACCAATTACTTCAAGAATTTGATCCAAA
AGAAAGGTCTTCTCGAATCAGATCAAGTTCTCTTTAGTGGTGGTTCCACCGATAGTATTGTCAAAGAATACAGCAAAAATCGTGCGGCTTTCAACGCAGATTTTGCATCAGCTATGATCA
AGATGGGAAATTATAAGCCACTCACTGGGTCTAAAGGTCAAATAAGGAGAATCTGCAGTGCAGTGAACAAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACAACTTCAGTTCGAAAAATCTCAGGAGCTTTCATGTTCACTGTCATGGTTTTGGTGTTATTGAACACCGCATGTCAAGCTAAACTCAACTCTAAGTATTATGAGAAATCATGTCCAA
AAGCTCTCGTTACTATCAGAAGTACCATCAGGACGGCTATTGCACGAGAACGAAGAATGGCAGCATCTCTCATTCGTCTGCACTTTCATGATTGTTTTGTCCAG
GGTTGTGATGCTTCAA
TCCTACTGGACGAGACGTCCTCTATCAAGAGTGAAAAGACTGCATTGCCCAACTTAAATTCTGCAAGAGGATTTGAAGTCATTGAAAAGGCAAAATCTGAAGTGGAGAAGATATGCCCAG
GTGTTGTATCCTGTGCAGATATCATTGCTGTGGCTGCAAGGGATGCTACTGAACAT
GTCGCTGGTCCATCTTACACTGTGTTGCTCGGAAGAAGAGATTCAACTACTGCAAGCAGGGATC
GAGCCAACAAGGAACTTCCTAGTTTTAGAGATGGCCTGAACAAACTTATATCTCGCTTTCAGAAAGTGGGACTCAATGCTAGGGACTTGGTTGCTTTGTCAG
GTTCTCATACTCTAGGAC
AAGCTCAGTGTGCAACATTTCGTGATAGGATATACAGCAATGGCAGTGACATTGATGCTGGATTTGCTACCACTCGCCGGCGTCGTTGTCCTGCTGTTGGAGGCGATGGAAATTTAGCTC
CACTTGATCTGGTCACACCCAATTCTTGGGACACCAATTACTTCAAGAATTTGATCCAAAAGAAAGGTCTTCTCGAATCAGATCAAGTTCTCTTTAGTGGTGGTTCCACCGATAGTATTG
TCAAAGAATACAGCAAAAATCGTGCGGCTTTCAACGCAGATTTTGCATCAGCTATGATCAAGATGGGAAATTATAAGCCACTCACTGGGTCTAAAGGTCAAATAAGGAGAATCTGCAGTG
CAGTGAACAAA

Retrieve as FASTA