Entry information : MePrx77 (cassava4.1_024428m)
Entry ID 9133
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx77 (cassava4.1_024428m)
Name (synonym) MePrx77 (cassava4.1_024428m)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx77
start..stop
S start..stop
RcPrx73 544 0 1..346 1..344
TsPrx09 537 0 1..346 1..352
BrPrx09-1Aa_other 535 0 1..346 1..347
ThasPrx40 531 0 1..346 1..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 67897..68166 270 N° 2 67301..67492 192 N° 3 67021..67186 166 N° 4 65871..66280 410
complement(join(65871..66280,67021..67186,67301..67492,67897..68166))


exon

Literature and cross-references MePrx77 (cassava4.1_024428m)
DNA ref. Phytozome 12:   scaffold09657 (68166..65871)
Protein sequence: MePrx77 (cassava4.1_024428m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (323)
PWM (Da):   %s   37453.93 (35056.6)  
PI (pH):   %s   6.65 (6.35) Peptide Signal:   %s   cut: 24 range:24-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALLKVTFGFTILSVLSFTGSLAHPGFSGWGGTDPIGGGGVSFGLFPEFYQFSCPQANDIVMSVLKKAIAEEPRMAASILRLHFHDCFVQGCDASILLDDSATVVSEKNSGPNRNSIRGFEVIDEIKAKLEEACPQIVSCADILALAARGSILLTGGPYWELPLGRRDSRAASLSGSNTNIPPPNSTIQNLITFFKRQGLNEVDLVALSGGHTIGVARCVTFKQRLYNQNGQNQRDETLEKTYYLGLKSVCPISGGDNNISPLDFSSPVRFDNSYFKLILCGKGLLTSDAVLFTGNIGYIMDLVRSFAEDEDFFFHQFAKSMVKMGNINPLTGFNGEIRKNCRGV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTGTTGAAAGTTACTTTTGGTTTCACCATACTGAGTGTCCTGTCATTCACTGGCTCCCTAGCTCACCCTGGTTTCTCTGGCTGGGGTGGTACTGACCCTATAGGTGGTGGTGGT
GTCTCATTTGGCTTATTTCCTGAATTTTATCAGTTTTCTTGCCCTCAAGCCAATGACATAGTCATGTCTGTCCTGAAGAAGGCTATCGCTGAGGAGCCTAGGATGGCTGCGTCTATTCTA
AGGCTTCATTTTCATGATTGCTTTGTGCAG
GTTTCACATCTGCCCACAAAGCTAGGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATTGGGAAAGGGTGTTCATGTGTTTT
ATCAAATTTAAATTATTTTATTCTCGATTTTTCTATTACTCAATTAAAATAACTTTTTTTTTTAAATCAAGTTCTATATTATTACACAAACATTAAATGGTCAACTTTTCCAAAATATAA
GTACGTTATAATTAAGTGATTAATAAATAGAAACTAAATAGTTAATTTTGAAAAAATATAAAACTTGATAGTAATTTATCATTGGAAAAAATGGCATAGTTTTGGCTATTTGATATAAAT
TTTTCAAAAGAAATATTCATAATAGGTTAATTTCTTGCTATATCAAGTATCCGAATTATTCATCTTAATTACAGGGCTGTGATGCGTCAATATTGCTGGACGATAGTGCAACAGTAGTGA
GTGAAAAGAATTCTGGACCAAACAGGAACTCCATTAGAGGATTTGAAGTAATTGACGAGATAAAAGCCAAGTTAGAAGAAGCATGCCCTCAAATCGTCTCTTGTGCTGATATTCTTGCCT
TAGCCGCTCGTGGCTCCATTCTACTT
GTAAGCAAAAGAAACTCAACCTCAAATTCTAAATTGCATTCAACTTCAGGATACATCTCAGAGATCAGAACATGATTTATCTATTTCTAATGCA
TTTCTCACTTCATGCTACAGACTGGTGGACCTTACTGGGAGCTCCCACTTGGAAGAAGGGACTCAAGGGCTGCAAGTCTAAGCGGCTCAAACACCAACATTCCACCACCCAACTCCACAA
TCCAAAACCTGATAACATTTTTCAAGCGTCAGGGTCTGAATGAGGTTGATCTTGTTGCACTATCAG
GTAAGAGAAATATTGTGGGTAATGGGTTTCTTTTGTTTTTAGCAAATTGTGCTT
CTCAACATTGGGAGTTTGATGTTTCGGCTAAATTTTGCCACCTGTACATATGAACTTATAAGTTGTACAACAAAACGCATGAACTTTGATTTATAATAATAAAGTACATCACCTTTTACC
TTCCTCATATAAAAATTAATATGAATATTCGTCTATTCGGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAAATCAAATTAGGAGAGAAATCAA
CATTCAGTTTGATTCACTTAATTAAGTTTTTTAACAGATTTTTTTATTTTTCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACAAAATACTGCTAGTCAATCCTTTAGAAAATTAGAAGGTTTTTATTTTTTTCTTAAACTAGAAA
ATAATATGGCATGTTCTTAAACTAGATGTTAGATCACAAACTAAAGCTGATGTATTTTACGAGTACCTTTTACCTTGATGTTTCAGGAGGTCATACAATTGGGGTGGCAAGGTGTGTGAC
CTTCAAGCAGAGGCTGTACAACCAAAATGGGCAAAATCAACGTGATGAGACTCTAGAGAAAACCTACTACTTAGGATTGAAGTCAGTTTGCCCAATATCAGGTGGTGACAATAACATCTC
CCCTTTGGATTTTTCCTCTCCTGTAAGATTTGACAACAGCTACTTCAAGCTCATTCTGTGTGGCAAAGGGCTTCTCACTTCAGACGCAGTGCTTTTCACAGGGAACATTGGCTACATTAT
GGACTTGGTTAGAAGCTTTGCTGAGGATGAGGACTTCTTCTTTCACCAATTTGCTAAATCAATGGTCAAGATGGGCAATATCAATCCCCTTACTGGTTTCAATGGTGAAATTAGGAAGAA
TTGTCGTGGGGTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTGTTGAAAGTTACTTTTGGTTTCACCATACTGAGTGTCCTGTCATTCACTGGCTCCCTAGCTCACCCTGGTTTCTCTGGCTGGGGTGGTACTGACCCTATAGGTGGTGGTGGT
GTCTCATTTGGCTTATTTCCTGAATTTTATCAGTTTTCTTGCCCTCAAGCCAATGACATAGTCATGTCTGTCCTGAAGAAGGCTATCGCTGAGGAGCCTAGGATGGCTGCGTCTATTCTA
AGGCTTCATTTTCATGATTGCTTTGTGCAG
GGCTGTGATGCGTCAATATTGCTGGACGATAGTGCAACAGTAGTGAGTGAAAAGAATTCTGGACCAAACAGGAACTCCATTAGAGGATTT
GAAGTAATTGACGAGATAAAAGCCAAGTTAGAAGAAGCATGCCCTCAAATCGTCTCTTGTGCTGATATTCTTGCCTTAGCCGCTCGTGGCTCCATTCTACTT
ACTGGTGGACCTTACTGG
GAGCTCCCACTTGGAAGAAGGGACTCAAGGGCTGCAAGTCTAAGCGGCTCAAACACCAACATTCCACCACCCAACTCCACAATCCAAAACCTGATAACATTTTTCAAGCGTCAGGGTCTG
AATGAGGTTGATCTTGTTGCACTATCAG
GAGGTCATACAATTGGGGTGGCAAGGTGTGTGACCTTCAAGCAGAGGCTGTACAACCAAAATGGGCAAAATCAACGTGATGAGACTCTAGAG
AAAACCTACTACTTAGGATTGAAGTCAGTTTGCCCAATATCAGGTGGTGACAATAACATCTCCCCTTTGGATTTTTCCTCTCCTGTAAGATTTGACAACAGCTACTTCAAGCTCATTCTG
TGTGGCAAAGGGCTTCTCACTTCAGACGCAGTGCTTTTCACAGGGAACATTGGCTACATTATGGACTTGGTTAGAAGCTTTGCTGAGGATGAGGACTTCTTCTTTCACCAATTTGCTAAA
TCAATGGTCAAGATGGGCAATATCAATCCCCTTACTGGTTTCAATGGTGAAATTAGGAAGAATTGTCGTGGGGTTAAT

Retrieve as FASTA