Entry information : MePrx80 (cassava4.1_024888m)
Entry ID 9135
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx80 (cassava4.1_024888m)
Name (synonym) MePrx80 (cassava4.1_024888m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx80
start..stop
S start..stop
MePrx89 659 0 1..334 1..334
MePrx141 598 0 1..334 1..335
RcPrx02 557 0 16..334 16..331
RcPrx04 515 0 11..334 5..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 378457..378687 231 N° 2 378802..379572 771  
join(378457..378687,378802..379572)


exon

Literature and cross-references MePrx80 (cassava4.1_024888m)
DNA ref. Phytozome 12:   scaffold09492 (378457..379572)
Protein sequence: MePrx80 (cassava4.1_024888m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334
PWM (Da):   %s   36058.81 Transmb domain:   %s   o15-37i
PI (pH):   %s   8.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSFKLNSLTTLPSFIVFLVFCSSVNVSFASLRVGFYRSSCPSAEAIVRKAVNKAVSQNPGLGAGLIRMHFHDCFVRGCDASVLLKSTPGNPSEREHVANNPSLRGFEVIDEAKAEIEALCPQTVSCADILAFAARDSSYKLGGINYVVPAGRRDGRVSREDEVGQNLPPFFFNAQQLADNFARKGMSVDEMVTLSGAHSIGVSHCSSFSSRLYNFNATHAQDPSMDPRYAAFLKTKCPPPSANRVDGGPTVALDPTPNRMDNKYYMELKKNRGLLTSDQTLMNSASTQMMVVNNARNAGTWAAKFAKAMVHMGSLDVLTGTDGEIRRQCSAAN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTAGCTTCAAGCTGAATTCTCTTACAACATTGCCCTCTTTCATTGTTTTCCTTGTGTTTTGCTCATCGGTTAATGTCTCTTTCGCATCCCTTAGAGTGGGATTTTATAGATCATCT
TGTCCATCGGCAGAAGCCATTGTGAGAAAAGCAGTAAACAAAGCCGTGTCTCAAAATCCAGGATTGGGTGCTGGCCTGATTAGGATGCATTTCCATGACTGCTTCGTCAGG
GTATACATG
CTCAAACCATATTATAATCTTTATATATTGTCATGGTTTTGTTTTGCTTGTTTTATTGCTTTAATATTTAATCAAACGCTAATGCGTTTATTTTGTATTTTGCAGGGCTGTGATGCTTCT
GTATTGCTGAAATCCACGCCAGGAAACCCATCAGAGAGAGAACATGTAGCCAATAATCCTAGTTTACGAGGTTTTGAGGTTATTGATGAAGCAAAGGCTGAAATTGAAGCCTTATGTCCA
CAAACTGTGTCGTGCGCAGATATTCTTGCTTTCGCTGCACGTGATAGTTCCTATAAGCTTGGAGGGATAAACTATGTAGTCCCAGCAGGACGGCGGGATGGACGTGTTTCTAGAGAGGAT
GAAGTGGGACAAAACCTCCCTCCTTTTTTCTTCAACGCACAGCAACTCGCAGACAATTTTGCCCGTAAAGGAATGTCAGTGGATGAGATGGTGACACTGTCTGGAGCACATTCCATTGGT
GTATCACACTGCTCTTCCTTCTCTAGTCGTCTCTACAACTTCAATGCCACTCATGCTCAAGATCCTTCCATGGATCCTAGGTATGCAGCTTTCTTGAAGACAAAGTGCCCTCCACCTAGT
GCTAATAGAGTTGATGGAGGTCCCACAGTTGCACTTGACCCTACCCCTAATCGCATGGACAATAAATACTACATGGAATTGAAGAAGAATCGAGGATTACTGACTTCGGACCAGACATTG
ATGAACAGTGCTTCCACACAGATGATGGTGGTGAACAATGCAAGGAATGCTGGAACATGGGCTGCCAAGTTTGCCAAGGCAATGGTACATATGGGTTCTCTCGATGTTCTTACAGGAACC
GATGGTGAAATCAGAAGACAATGCAGTGCCGCGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTAGCTTCAAGCTGAATTCTCTTACAACATTGCCCTCTTTCATTGTTTTCCTTGTGTTTTGCTCATCGGTTAATGTCTCTTTCGCATCCCTTAGAGTGGGATTTTATAGATCATCT
TGTCCATCGGCAGAAGCCATTGTGAGAAAAGCAGTAAACAAAGCCGTGTCTCAAAATCCAGGATTGGGTGCTGGCCTGATTAGGATGCATTTCCATGACTGCTTCGTCAGG
GGCTGTGAT
GCTTCTGTATTGCTGAAATCCACGCCAGGAAACCCATCAGAGAGAGAACATGTAGCCAATAATCCTAGTTTACGAGGTTTTGAGGTTATTGATGAAGCAAAGGCTGAAATTGAAGCCTTA
TGTCCACAAACTGTGTCGTGCGCAGATATTCTTGCTTTCGCTGCACGTGATAGTTCCTATAAGCTTGGAGGGATAAACTATGTAGTCCCAGCAGGACGGCGGGATGGACGTGTTTCTAGA
GAGGATGAAGTGGGACAAAACCTCCCTCCTTTTTTCTTCAACGCACAGCAACTCGCAGACAATTTTGCCCGTAAAGGAATGTCAGTGGATGAGATGGTGACACTGTCTGGAGCACATTCC
ATTGGTGTATCACACTGCTCTTCCTTCTCTAGTCGTCTCTACAACTTCAATGCCACTCATGCTCAAGATCCTTCCATGGATCCTAGGTATGCAGCTTTCTTGAAGACAAAGTGCCCTCCA
CCTAGTGCTAATAGAGTTGATGGAGGTCCCACAGTTGCACTTGACCCTACCCCTAATCGCATGGACAATAAATACTACATGGAATTGAAGAAGAATCGAGGATTACTGACTTCGGACCAG
ACATTGATGAACAGTGCTTCCACACAGATGATGGTGGTGAACAATGCAAGGAATGCTGGAACATGGGCTGCCAAGTTTGCCAAGGCAATGGTACATATGGGTTCTCTCGATGTTCTTACA
GGAACCGATGGTGAAATCAGAAGACAATGCAGTGCCGCGAAC

Retrieve as FASTA