Entry information : MePrx87 (cassava4.1_025889m)
Entry ID 9142
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx87 (cassava4.1_025889m)
Name (synonym) MePrx87 (cassava4.1_025889m)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx87
start..stop
S start..stop
MePrx09 521 0 10..349 7..351
RcPrx11 519 0 22..349 23..354
EcPrx01 507 0 10..349 5..347
RcPrx47 498 1e-178 1..349 1..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 392894..393139 246 N° 2 393243..393425 183 N° 3 393515..394132 618  
join(392894..393139,393243..393425,393515..394132)


exon

Literature and cross-references MePrx87 (cassava4.1_025889m)
DNA ref. Phytozome 12:   scaffold07519 (392894..394132)
Protein sequence: MePrx87 (cassava4.1_025889m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (322)
PWM (Da):   %s   38152.41 (35336.9) Transmb domain:   %s   i7-25o
PI (pH):   %s   6.15 (6.51) Peptide Signal:   %s   cut: 28 range:28-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIAPSVTCLLLTSSLLLASWFIAIEAQSRPPIVNGLSWTFYQSSCPKLESIIRNELKKIFKEDVGQAAGLLRLHSHDCFVLGCDGSVLLDKSNERSEIPNLTMRKEAFKIVNDLRERVHKQCGCVVSCADILTIAARDSVFLTGGPDYDVPLGRRDGVKMAEVNQTFVDLVAPFATTGTVLAKFARKGLDATDTVALSGAHTIGISQCSSFTDRLYPRQDPNMDKSFANNLKQICPRPNSNAVTVLDIRTPDIFDNKYFVDLMNRQGLFTSDQDLFIDARTKDIVTSFAVNEGLFFEKFVLAMIKMGQIEVLTGGQGEIRGDCSVRNSDNNKLASVVGEDLGSSSKMK

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATTGCTCCATCTGTCACTTGTCTCCTTCTGACCTCCTCTCTCTTACTTGCTTCTTGGTTTATTGCCATTGAAGCACAAAGCAGACCTCCAATAGTGAATGGTCTCTCCTGGACA
TTCTACCAATCTTCTTGTCCTAAACTTGAATCCATCATCAGAAATGAGCTCAAGAAAATTTTCAAGGAGGACGTTGGCCAAGCTGCTGGGTTGCTTCGTCTACACTCCCATGACTGCTTT
GTTCTG
GTCACTATTATTTATATACATTAATTTCTTGTTTATTGTGTCATTCTACCTAGATAAAGTTTATAATATGCATGATTTAATATTTTACGTGAATATTTTACAGGGATGTGATGG
ATCTGTGCTGCTTGATAAATCCAATGAAAGATCTGAAATTCCCAACTTGACAATGAGAAAAGAGGCATTTAAGATCGTCAATGACCTCCGCGAGCGTGTTCATAAGCAGTGTGGCTGTGT
CGTCTCTTGCGCTGATATTCTTACAATCGCCGCTCGTGACTCCGTTTTCTTG
GTAAATCGCTGATAGTGACTCCGTTTTCTTGCTCGTATTTAAGTGAACTTCTACTTACTGTGCATTTT
CTCCTTGTGGGGTTATCACAGACCGGCGGTCCTGACTACGATGTCCCGTTGGGAAGACGAGACGGAGTGAAGATGGCAGAAGTAAATCAAACTTTTGTTGACTTGGTAGCACCCTTCGCC
ACCACCGGCACAGTCCTGGCGAAATTTGCTAGAAAGGGCTTAGATGCCACTGATACAGTAGCCCTCTCAGGTGCCCACACCATCGGAATCAGCCAGTGCAGCTCATTCACCGATCGTCTT
TATCCCAGGCAAGACCCCAACATGGACAAAAGCTTCGCAAATAATCTCAAACAAATTTGTCCCAGACCAAACTCCAATGCTGTTACAGTACTGGACATTCGAACTCCCGACATATTTGAC
AACAAATACTTCGTTGATCTTATGAACCGTCAGGGTTTATTTACCTCAGACCAAGACCTGTTCATAGATGCCAGGACAAAGGACATTGTTACAAGCTTTGCTGTTAATGAAGGTTTGTTC
TTTGAGAAGTTTGTTCTTGCCATGATCAAGATGGGGCAAATCGAAGTGTTGACAGGCGGACAAGGTGAAATTCGTGGAGATTGCTCAGTGAGGAATTCTGATAATAATAAATTGGCGTCT
GTGGTAGGAGAGGATTTAGGTTCATCTTCTAAAATGAAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATTGCTCCATCTGTCACTTGTCTCCTTCTGACCTCCTCTCTCTTACTTGCTTCTTGGTTTATTGCCATTGAAGCACAAAGCAGACCTCCAATAGTGAATGGTCTCTCCTGGACA
TTCTACCAATCTTCTTGTCCTAAACTTGAATCCATCATCAGAAATGAGCTCAAGAAAATTTTCAAGGAGGACGTTGGCCAAGCTGCTGGGTTGCTTCGTCTACACTCCCATGACTGCTTT
GTTCTG
GGATGTGATGGATCTGTGCTGCTTGATAAATCCAATGAAAGATCTGAAATTCCCAACTTGACAATGAGAAAAGAGGCATTTAAGATCGTCAATGACCTCCGCGAGCGTGTTCAT
AAGCAGTGTGGCTGTGTCGTCTCTTGCGCTGATATTCTTACAATCGCCGCTCGTGACTCCGTTTTCTTG
ACCGGCGGTCCTGACTACGATGTCCCGTTGGGAAGACGAGACGGAGTGAAG
ATGGCAGAAGTAAATCAAACTTTTGTTGACTTGGTAGCACCCTTCGCCACCACCGGCACAGTCCTGGCGAAATTTGCTAGAAAGGGCTTAGATGCCACTGATACAGTAGCCCTCTCAGGT
GCCCACACCATCGGAATCAGCCAGTGCAGCTCATTCACCGATCGTCTTTATCCCAGGCAAGACCCCAACATGGACAAAAGCTTCGCAAATAATCTCAAACAAATTTGTCCCAGACCAAAC
TCCAATGCTGTTACAGTACTGGACATTCGAACTCCCGACATATTTGACAACAAATACTTCGTTGATCTTATGAACCGTCAGGGTTTATTTACCTCAGACCAAGACCTGTTCATAGATGCC
AGGACAAAGGACATTGTTACAAGCTTTGCTGTTAATGAAGGTTTGTTCTTTGAGAAGTTTGTTCTTGCCATGATCAAGATGGGGCAAATCGAAGTGTTGACAGGCGGACAAGGTGAAATT
CGTGGAGATTGCTCAGTGAGGAATTCTGATAATAATAAATTGGCGTCTGTGGTAGGAGAGGATTTAGGTTCATCTTCTAAAATGAAA

Retrieve as FASTA