Entry information : MePrx89 (cassava4.1_026282m)
Entry ID 9144
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-25 (Christophe Dunand)
Peroxidase information: MePrx89 (cassava4.1_026282m)
Name (synonym) MePrx89 (cassava4.1_026282m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx89
start..stop
S start..stop
MePrx80 659 0 1..334 1..334
MePrx141 602 0 1..334 1..335
RcPrx02 555 0 16..334 16..331
RcPrx04 515 0 12..334 6..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 381869..382099 231 N° 2 382219..382989 771  
join(381869..382099,382219..382989)


exon

Literature and cross-references MePrx89 (cassava4.1_026282m)
DNA ref. Phytozome 12:   scaffold09492 (381869..382989)
Protein sequence: MePrx89 (cassava4.1_026282m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334
PWM (Da):   %s   35959.91 Transmb domain:   %s   i7-29o
PI (pH):   %s   8.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSFKLNSLMILPSFIVFLVFCSLATVSFASLRVGFYRSSCPSAEAIVRKAVNKAVSQNPGLGAGLIRMHFHDCFVRGCDASVLLKSTLGNPSEREHVANNPSLRGFEVIDEAKAEIEALCPQTVSCADILAFAARDSSYKLGGINYVVPAGRRDGRVSREDEVGQNLPPFFFNAQQLADNFARKGMSVDEMVTLSGAHSIGVSHCSSFSSRLYNFNATHAQDPSMDPKYAAFLKTTCPPPSANGVGGGSTVALDPTPNRMDNKYYMELKKNRGLLTSDQTLMNSASTQRMVVNNARKAGTWAAKFAKAMVHMGSLDVLTGTQGEIRRQCSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTAGTTTCAAGTTGAATTCTCTTATGATATTGCCATCTTTCATTGTTTTCCTTGTGTTTTGCTCATTAGCTACTGTCTCTTTTGCATCCCTTAGAGTGGGATTCTATAGATCATCT
TGTCCATCAGCAGAAGCCATTGTGAGAAAAGCAGTAAACAAAGCTGTGTCTCAAAATCCAGGGTTAGGTGCTGGCCTGATTAGGATGCATTTCCATGATTGCTTTGTTAGG
GTACGTATA
CATGCGCAAACTTTATCTACTTATTTTAATACTATAATGTTTATATATGACAAGTTTTTGTTTTGTTGCTTCAATATTTAAATGCTGATGGTTCGTGCTATGTTTAACAGGGTTGTGATG
CTTCTGTGTTGCTGAAATCTACACTAGGGAACCCATCAGAGAGAGAACACGTAGCTAATAATCCTAGCTTACGAGGTTTTGAGGTTATTGATGAAGCAAAGGCTGAAATTGAAGCCTTAT
GTCCACAAACTGTGTCGTGCGCAGATATTCTTGCTTTCGCTGCACGTGATAGTTCCTATAAGCTTGGAGGGATAAACTATGTAGTCCCAGCAGGACGGCGGGACGGACGTGTTTCTAGAG
AGGATGAAGTGGGACAAAACCTCCCTCCTTTTTTCTTCAACGCACAGCAACTCGCAGACAATTTTGCCCGTAAAGGAATGTCAGTGGATGAGATGGTGACACTATCTGGAGCACATTCCA
TTGGTGTATCACACTGCTCTTCCTTCTCCAGTCGTCTCTACAACTTCAATGCCACTCATGCTCAAGATCCCTCCATGGATCCTAAGTATGCAGCTTTCTTGAAGACAACGTGCCCTCCAC
CAAGTGCTAATGGAGTGGGAGGAGGTTCAACAGTTGCACTTGATCCTACCCCTAATCGCATGGACAATAAATACTACATGGAATTGAAGAAGAATCGAGGATTATTGACTTCGGATCAGA
CATTGATGAACAGTGCTTCTACACAGAGGATGGTGGTGAATAATGCAAGGAAAGCTGGAACATGGGCTGCCAAGTTTGCCAAGGCGATGGTGCATATGGGTTCACTCGACGTTCTCACAG
GAACTCAAGGTGAAATCAGAAGGCAATGCAGTGCTGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTAGTTTCAAGTTGAATTCTCTTATGATATTGCCATCTTTCATTGTTTTCCTTGTGTTTTGCTCATTAGCTACTGTCTCTTTTGCATCCCTTAGAGTGGGATTCTATAGATCATCT
TGTCCATCAGCAGAAGCCATTGTGAGAAAAGCAGTAAACAAAGCTGTGTCTCAAAATCCAGGGTTAGGTGCTGGCCTGATTAGGATGCATTTCCATGATTGCTTTGTTAGG
GGTTGTGAT
GCTTCTGTGTTGCTGAAATCTACACTAGGGAACCCATCAGAGAGAGAACACGTAGCTAATAATCCTAGCTTACGAGGTTTTGAGGTTATTGATGAAGCAAAGGCTGAAATTGAAGCCTTA
TGTCCACAAACTGTGTCGTGCGCAGATATTCTTGCTTTCGCTGCACGTGATAGTTCCTATAAGCTTGGAGGGATAAACTATGTAGTCCCAGCAGGACGGCGGGACGGACGTGTTTCTAGA
GAGGATGAAGTGGGACAAAACCTCCCTCCTTTTTTCTTCAACGCACAGCAACTCGCAGACAATTTTGCCCGTAAAGGAATGTCAGTGGATGAGATGGTGACACTATCTGGAGCACATTCC
ATTGGTGTATCACACTGCTCTTCCTTCTCCAGTCGTCTCTACAACTTCAATGCCACTCATGCTCAAGATCCCTCCATGGATCCTAAGTATGCAGCTTTCTTGAAGACAACGTGCCCTCCA
CCAAGTGCTAATGGAGTGGGAGGAGGTTCAACAGTTGCACTTGATCCTACCCCTAATCGCATGGACAATAAATACTACATGGAATTGAAGAAGAATCGAGGATTATTGACTTCGGATCAG
ACATTGATGAACAGTGCTTCTACACAGAGGATGGTGGTGAATAATGCAAGGAAAGCTGGAACATGGGCTGCCAAGTTTGCCAAGGCGATGGTGCATATGGGTTCACTCGACGTTCTCACA
GGAACTCAAGGTGAAATCAGAAGGCAATGCAGTGCTGTCAAC

Retrieve as FASTA