Entry information : MePrx96 (cassava4.1_027488m)
Entry ID 9149
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx96 (cassava4.1_027488m)
Name (synonym) MePrx96 (cassava4.1_027488m)
Class Class III peroxidase    [Orthogroup: Prx097]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx96
start..stop
S start..stop
PtPrx104 480 2e-172 2..321 1..324
PpePrx71 421 6e-149 26..320 49..349
PpePrx49 418 7e-148 32..320 40..335
MePrx118 418 8e-148 26..320 42..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 209015..209251 237 N° 2 211285..212010 726  
join(209015..209251,211285..212010)


exon

Literature and cross-references MePrx96 (cassava4.1_027488m)
DNA ref. Phytozome 12:   scaffold10609 (209015..212010)
Protein sequence: MePrx96 (cassava4.1_027488m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321
PWM (Da):   %s   35611.63  
PI (pH):   %s   9.21
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVVSGSIPLVQKPFTAILPKPHISPNTLPFKDVLSSVYYLNKCPQAEGIIQQKVKAWFHKNYTLAASLIRLHFHDCAVRGCDASILLNHKGSERRALASKTLRGFQVIDDIKAEVEKSCPKTVSCADILTAAARDATVLLGGPFWEVPFGRKDGKISISKEADMVPQGHENVTQLIDFFQARGLSILDLVVLSGSHTIGRSTCYSILHRLAKFDPTLDRKYLKNLTRSCKWSNDFVHLDVTTPTAFDIEYYKNLGKKMGLLSTDQALFLDPRTSPFVSALATQPDLFFNQFAVSMVNLGNILIPAHLNQKEVRLNCNYVNP

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTGTGTCAGGCTCCATACCACTCGTTCAGAAACCCTTCACTGCTATTTTACCAAAGCCTCACATTTCACCAAATACTCTGCCTTTTAAAGATGTTTTGTCCTCTGTTTACTATCTT
AATAAATGTCCACAAGCTGAAGGAATCATCCAACAAAAGGTGAAGGCTTGGTTCCACAAGAATTACACATTGGCTGCCAGCCTCATTCGCTTACACTTCCATGACTGTGCTGTTAGG
GTA
AGCCTTTACCACGCTTTAATTTGTTTTCTGTCCTTGATTTTGAGGGTATGTTGCATATTGCTATTTGAATAGGAGGTAGAGAATCAGTAGCAGCAATTTTTCAAATGAGAAATCCAATTG
CAAACCCTCACTTTGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTGAAATAAATAGAGTGAAAATGCAA
TTAGTTTTTTAGCCTATAGTTTGTGTTATTAAGGAGATTTGATCTCATACATAAATATTCCTCTGCACTTATTGCCTTAAACGCTATACTTTTTTTTTTTTCCTCCAATCAATTGTATCT
ACTGTATTTTATAATTTCCACGACATTTGTGTAAGTTATTGCATAATTTCTTACTTCACTATTTTTCTATTCACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGTTCCGTTATTTCGCTGTAAAGTTACAAACAAATGCATTAGTGGAAATTACAAGCAGTATTAATTAAGGG
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTAACTTAAGACCCATATATTTATGTATTAG
AATTGACTTGATTTACAATGGAAAGTCACTTAAAAGNNNNNNNNNNNNNNNNNNNNNNNCTTAAAGATGGTTTAATTTTTCTATGAATAAAAATATTTCAATTATCAATTTTTTAGAGCA
CCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACAAAATAGACGAAGTTTTAAGCTGAATGTTTTTGAAGATGAAGTGTTTTGAATAAAAAAGTTAAATCTTTTA
AAAAGTGTTTAATACAATGAAAATTATAAATTTAAGTATGTGATGTCNNNNNNNNNNNNNNNNNNNNNGTGTTCTTTAACATGGCAAATCTTAGTTTATTGTTTGTAAAGAAACTTGTTA
GTCTCGTTATAGCTATTTTTTCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
CTTATTAAAAGATAATAGAGATGTATGATGAGAAAATTATAAAATGCAAAGCAAATTTATGAGTTAGCAGTGCAGTAATATTGATTCGAGAACNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATGGCCTGGGTTTTCTTATTGATTTTTACGATATAAAAGTACAGTGGTAAATTTTATTTACTTGCTACACTAAC
CTTTTCTTTTCTTTTTTTTTTAAAAAAGATTTCTATTAAAAATAACAATTTGGAACATGCTTGGAGTATATATGACTATTTTACTATGTTTATTTTTCTCAATATTGTAGGGGTGTGATG
CTTCAATTTTGTTAAACCATAAAGGAAGTGAAAGGAGGGCATTGGCCAGCAAGACACTAAGAGGTTTCCAAGTGATTGATGATATCAAAGCAGAAGTAGAGAAGAGTTGTCCTAAAACTG
TCTCTTGCGCAGACATTCTTACAGCTGCTGCTAGAGATGCCACTGTGCTACTTGGAGGTCCATTTTGGGAAGTCCCTTTTGGCAGAAAAGATGGCAAAATTTCCATTTCCAAAGAAGCTG
ACATGGTTCCTCAGGGCCATGAAAATGTTACTCAATTGATTGATTTCTTCCAAGCAAGAGGCTTGAGCATACTAGACTTGGTTGTCCTCTCAGGTTCACACACAATAGGCAGGAGCACTT
GCTATTCTATCCTGCACAGGCTAGCCAAGTTTGATCCTACACTTGATAGAAAATATTTGAAGAACTTGACAAGGTCATGTAAATGGAGCAATGACTTTGTGCACCTTGATGTGACAACTC
CAACAGCTTTTGATATAGAGTATTACAAGAATCTCGGAAAGAAGATGGGATTGCTGTCAACTGATCAAGCACTCTTCTTGGATCCAAGAACTTCACCTTTTGTTTCTGCATTGGCAACTC
AGCCTGACCTCTTCTTTAACCAGTTTGCTGTGTCTATGGTGAATCTTGGAAATATTCTGATCCCAGCTCATCTCAATCAGAAAGAAGTCAGATTGAATTGCAATTATGTTAATCCT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTGTGTCAGGCTCCATACCACTCGTTCAGAAACCCTTCACTGCTATTTTACCAAAGCCTCACATTTCACCAAATACTCTGCCTTTTAAAGATGTTTTGTCCTCTGTTTACTATCTT
AATAAATGTCCACAAGCTGAAGGAATCATCCAACAAAAGGTGAAGGCTTGGTTCCACAAGAATTACACATTGGCTGCCAGCCTCATTCGCTTACACTTCCATGACTGTGCTGTTAGG
GGG
TGTGATGCTTCAATTTTGTTAAACCATAAAGGAAGTGAAAGGAGGGCATTGGCCAGCAAGACACTAAGAGGTTTCCAAGTGATTGATGATATCAAAGCAGAAGTAGAGAAGAGTTGTCCT
AAAACTGTCTCTTGCGCAGACATTCTTACAGCTGCTGCTAGAGATGCCACTGTGCTACTTGGAGGTCCATTTTGGGAAGTCCCTTTTGGCAGAAAAGATGGCAAAATTTCCATTTCCAAA
GAAGCTGACATGGTTCCTCAGGGCCATGAAAATGTTACTCAATTGATTGATTTCTTCCAAGCAAGAGGCTTGAGCATACTAGACTTGGTTGTCCTCTCAGGTTCACACACAATAGGCAGG
AGCACTTGCTATTCTATCCTGCACAGGCTAGCCAAGTTTGATCCTACACTTGATAGAAAATATTTGAAGAACTTGACAAGGTCATGTAAATGGAGCAATGACTTTGTGCACCTTGATGTG
ACAACTCCAACAGCTTTTGATATAGAGTATTACAAGAATCTCGGAAAGAAGATGGGATTGCTGTCAACTGATCAAGCACTCTTCTTGGATCCAAGAACTTCACCTTTTGTTTCTGCATTG
GCAACTCAGCCTGACCTCTTCTTTAACCAGTTTGCTGTGTCTATGGTGAATCTTGGAAATATTCTGATCCCAGCTCATCTCAATCAGAAAGAAGTCAGATTGAATTGCAATTATGTTAAT
CCT

Retrieve as FASTA