Entry information : MePrx97 (cassava4.1_027519m)
Entry ID 9150
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: MePrx97 (cassava4.1_027519m)
Name (synonym) MePrx97 (cassava4.1_027519m)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx97
start..stop
S start..stop
MePrx108 567 0 1..328 1..329
MePrx110 566 0 1..328 1..329
RcPrx43 557 0 1..328 1..330
PtPrx91 504 0 1..328 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 250863..251081 219 N° 2 250552..250737 186 N° 3 250285..250450 166 N° 4 249791..250203 413
complement(join(249791..250203,250285..250450,250552..250737,250863..251081))


exon

Literature and cross-references MePrx97 (cassava4.1_027519m)
DNA ref. Phytozome 12:   scaffold04895 (251081..249791)
Protein sequence: MePrx97 (cassava4.1_027519m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (302)
PWM (Da):   %s   35542.5 (32644.9) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.81 (9.71) Peptide Signal:   %s   cut: 27 range:27-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASKSFSLLLLQFIFVLFVFNPVNAQLKVGFYSKTCPQAEAIVKEVIDQVMSVAPSLAGPLLRMHFHDCFVRGCDGSVLLNSSTQQAEKNAPPNLSLRGFQIIDRVKSALEKACPGVVSCADIVAIVARDVTVATKGPRWEVETGRRDGRVSKLIEASNNLIAPTANITTVIAGFRAKGLSIKDAAVLLGGHTIGTSHCSSFNSRLYNFTGKGINNDSDPTLDSEYVERLKKKCKPRDQKTLVEMDPGSFRTFDADYYTLVSKRRGLFQSDAALLDNSVTKAYVKLQAATKGFTFFKDFGESMVKMGRVGVVTGTSGEIRKVCSKV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTTCAAAATCATTTTCACTTCTTCTTCTCCAATTCATCTTTGTTTTATTTGTGTTTAACCCAGTGAATGCTCAACTGAAAGTAGGGTTTTACTCCAAAACTTGCCCACAAGCT
GAGGCCATTGTTAAGGAGGTTATTGATCAAGTCATGTCAGTGGCTCCTTCTCTTGCTGGCCCCTTGTTGAGGATGCATTTTCATGATTGCTTTGTTAGG
GTAAGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCAGTAATATATAATCGAACTATACGATTACGTACAAAGATTATGATTATGTAAGGGTAATTATAATTTATTTATGTCTTCAGGGTTGTGATGGGTCAG
TACTGTTAAACTCCAGTACTCAGCAAGCTGAGAAAAATGCACCTCCAAATCTGAGCCTTCGAGGATTCCAAATTATCGACAGAGTCAAATCTGCCTTGGAAAAGGCATGCCCTGGTGTGG
TTTCATGTGCAGACATCGTGGCTATTGTGGCTAGGGATGTCACAGTTGCG
GTAATTAGCATTTTAATCTCTTTTCCTTTAAATTTGCTATTAACAAAAATCAAAGAGTGAAAAGAATTAA
TAATTGTACAAATAAAATTTGATCGTCTCAGACCAAGGGACCTCGATGGGAAGTTGAAACTGGACGAAGAGATGGAAGAGTTTCCAAATTAATAGAAGCCTCTAACAACTTGATAGCTCC
TACTGCTAACATTACCACTGTAATAGCAGGATTTCGAGCTAAGGGTTTGAGCATAAAAGATGCAGCGGTGCTATTAG
GTATGTAAAAATTAACCATGCATTAATGCTTGTTAACTCTACA
GCTGGAATCTTAACTCTGATCTCTTTGGGGTGACACAGGTGGCCACACCATTGGTACTTCTCACTGCTCTTCATTCAATTCCAGGCTTTACAATTTCACTGGAAAGGGAATCAATAATGA
CTCTGATCCTACATTGGATTCAGAGTATGTTGAAAGGTTGAAAAAGAAATGCAAGCCAAGAGATCAAAAAACACTGGTAGAAATGGATCCTGGGAGCTTCAGGACATTTGATGCAGACTA
CTATACACTTGTGAGCAAAAGAAGAGGTCTCTTCCAGTCTGATGCAGCTCTCCTTGACAACAGTGTGACAAAAGCTTACGTTAAGCTTCAGGCTGCCACCAAGGGATTCACTTTCTTCAA
AGACTTTGGTGAGTCAATGGTGAAGATGGGTAGGGTTGGAGTTGTTACAGGTACATCAGGTGAAATCAGGAAAGTGTGCAGCAAGGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTTCAAAATCATTTTCACTTCTTCTTCTCCAATTCATCTTTGTTTTATTTGTGTTTAACCCAGTGAATGCTCAACTGAAAGTAGGGTTTTACTCCAAAACTTGCCCACAAGCT
GAGGCCATTGTTAAGGAGGTTATTGATCAAGTCATGTCAGTGGCTCCTTCTCTTGCTGGCCCCTTGTTGAGGATGCATTTTCATGATTGCTTTGTTAGG
GGTTGTGATGGGTCAGTACTG
TTAAACTCCAGTACTCAGCAAGCTGAGAAAAATGCACCTCCAAATCTGAGCCTTCGAGGATTCCAAATTATCGACAGAGTCAAATCTGCCTTGGAAAAGGCATGCCCTGGTGTGGTTTCA
TGTGCAGACATCGTGGCTATTGTGGCTAGGGATGTCACAGTTGCG
ACCAAGGGACCTCGATGGGAAGTTGAAACTGGACGAAGAGATGGAAGAGTTTCCAAATTAATAGAAGCCTCTAAC
AACTTGATAGCTCCTACTGCTAACATTACCACTGTAATAGCAGGATTTCGAGCTAAGGGTTTGAGCATAAAAGATGCAGCGGTGCTATTAG
GTGGCCACACCATTGGTACTTCTCACTGC
TCTTCATTCAATTCCAGGCTTTACAATTTCACTGGAAAGGGAATCAATAATGACTCTGATCCTACATTGGATTCAGAGTATGTTGAAAGGTTGAAAAAGAAATGCAAGCCAAGAGATCAA
AAAACACTGGTAGAAATGGATCCTGGGAGCTTCAGGACATTTGATGCAGACTACTATACACTTGTGAGCAAAAGAAGAGGTCTCTTCCAGTCTGATGCAGCTCTCCTTGACAACAGTGTG
ACAAAAGCTTACGTTAAGCTTCAGGCTGCCACCAAGGGATTCACTTTCTTCAAAGACTTTGGTGAGTCAATGGTGAAGATGGGTAGGGTTGGAGTTGTTACAGGTACATCAGGTGAAATC
AGGAAAGTGTGCAGCAAGGTTAAC

Retrieve as FASTA